معلومة

على أي بقايا أحماض أمينية تعمل الـ SDS؟

على أي بقايا أحماض أمينية تعمل الـ SDS؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أود أن أعرف بالضبط ما هي آلية SDS ، وأود أن أعرف ما هي الأحماض الأمينية المتبقية التي يعمل عليها SDS.

هل يمكنك مساعدتي من فضلك ؟

شكرا لكم مقدما !


إذا كنت تتحدث عن Sodium Dodecyl Sulfate (منظف) فإن لها وظيفتان رئيسيتان:

(1) إنه يعطل جميع الروابط غير التساهمية في البروتينات ، أي الروابط الهيدروجينية من السلسلة الرئيسية ، أو الروابط الهيدروجينية بين البقايا التي تعتمد على شكل البروتين.

(2) يغلف البروتينات بشحنة سالبة وهو أمر مفيد للتقنيات المعملية مثل الرحلان الكهربائي للهلام.

سؤالك ينص على "ما هي بقايا الأحماض الأمينية التي تعمل عليها؟يمكنك أن تكون آمنًا بافتراض أن SDS ستغطي البروتين بأكمله. ويكفي حوالي 0.1٪ من محلول SDS لتكثيف سلاسل جزيئات جزيئات البروتين المتعددة من جزيئات SDS بحوالي جزيء SDS واحد لكل بقايا حمض أميني.


تشير ترددات سلاسل الأحماض الأمينية في تسلسل البروتينات الكروية إلى قمع كتل المخلفات المتتالية الكارهة للماء

تلعب أنماط المخلفات الكارهة للماء والماء دورًا رئيسيًا في طي البروتين ووظيفته. سلاسل طويلة ، كارهة للماء في الغالب من 20 إلى 22 من الأحماض الأمينية ، ترتبط كل منها بحلزون عبر الغشاء وقد تم استخدامها لتحديد مثل هذه التسلسلات. تم إيلاء اهتمام أقل للتسلسلات الكارهة للماء داخل البروتينات الكروية. في عمل سابق على محاكاة الكمبيوتر للمنافسة بين تشكيل التجميع القابل للطي على المسار وخارجه ، وجدنا أن التسلسلات الطويلة من المخلفات الكارهة للماء المتتالية عززت التجميع داخل النموذج ، حتى التحكم في المحتوى الكلي الكارهة للماء. نقدم تقريرًا هنا عن تحليل ترددات أطوال مختلفة من الكتل المتجاورة من المخلفات الكارهة للماء في قاعدة بيانات لتسلسل الأحماض الأمينية لبروتينات ذات بنية معروفة. تم العثور على تسلسل من ثلاثة أو أكثر من المخلفات الكارهة للماء متتالية أقل شيوعًا بشكل ملحوظ في البروتينات الكروية الفعلية مما يمكن توقعه إذا تم اختيار البقايا بشكل مستقل. قد تعكس النتيجة الانتقاء مقابل كتل طويلة من البقايا الكارهة للماء داخل البروتينات الكروية بالنسبة إلى ما يمكن توقعه إذا كانت المواد الكارهة للماء المتبقية مستقلة عن تلك البقايا القريبة في التسلسل.

الأرقام

مؤامرة نصف لوغاريتمية للقيم المقاسة ...

مخطط نصف لوغاريتمي للقيم المقاسة لتوزيعات طول الكتلة الكارهة للماء والقيم المتوقعة ...

مؤامرة نصف لوغاريتمية تم قياسها و ...

مخطط نصف لوغاريتمي للقيم المقاسة والمتوقعة لتوزيعات طول الكتلة الكارهة للماء لـ ...

المخططات شبه السجلية المقاسة و ...

المخططات شبه اللوغاريتمية للقيم المقاسة والمتوقعة لتوزيعات أطوال الكتلة الكارهة للماء لـ ...

مخطط شريطي لهيكل UDP- ن - أسيتيل جلوكوزامين إنولبيروفيل ترانسفيراز ك ...


  • خدمات
    • التوثيق والتحليل الهلامي أحادي الأبعاد وثنائي الأبعاد
    • 2-D الكهربائي للهلام
    • جهاز استشراب سائل عالي الأداء (HPLC)
    • خدمات الورم الهجين
    • في الهلام وحل الهضم
    • التركيز الكهروضوئي (IEF)
    • تحليل الكتلة MALDI
    • تخليق الببتيد
    • تسلسل البروتين / الببتيد
    • Q مطياف الكتلة الترادفية الفائقة (LC-MS / MS)
    • SDS-PAGE و Electroblotting
    • Synapt G2-Si HDMS
    • نظام تصوير تايفون
    • إنشاء استمارات التقديم
    • الندوات القادمة
    • الندوات السابقة
    • كتيبات
    • أخبار
    • معلومة اضافية

    تسلسل البروتين / الببتيد N-terminal

    متطلبات العينة

    تستخدم منشأة البروتين مُسلسِل البروتين المتدرج Shimadzu PPSQ-53A. العملية الكيميائية المستخدمة من قبل منظم البروتين لتحديد تسلسل الأحماض الأمينية مشتقة من طريقة التحلل التي طورها Edman.

    في هذا التفاعل يتفاعل فينيل أيزوثيوسيانات (PITC) مع بقايا الأحماض الأمينية عند الطرف الأميني في ظل الظروف الأساسية (التي يوفرها n-methylpiperidine / methanol / water) لتكوين مشتق phenylthiocarbamyl (PTC-protein). ثم يشق حمض Trifluoroacetic الحمض الأميني الأول كمشتق anilinothialinone (حمض أميني ATZ) ويترك النهاية الأمينية الجديدة لدورة التحلل التالية. يتم بعد ذلك إزالة الحمض الأميني ATZ عن طريق الاستخلاص باستخدام N-butyl chloride وتحويله إلى مشتق phenylthiohydantoin (PTH-amino acid) مع 25٪ TFA / ماء (انظر الشكل 1). يتم أيضًا تكوين العديد من المنتجات الثانوية أثناء كيمياء التحلل في Edman وهي موضحة في الشكل 2. يتم نقل PTH-amino acid إلى عمود C-18 ذي الطور العكسي للكشف عند 270 نانومتر. يتم أيضًا حقن خليط قياسي من 19 من الأحماض الأمينية PTH في العمود للفصل (عادةً ما تكون الدورة الأولى من سلسلة التسلسل). يوفر هذا الكروماتوجرام أوقات الاحتفاظ القياسية للأحماض الأمينية للمقارنة مع كل كروماتوجرام دورة تدهور Edman. يتم جمع مخططات كروماتوجرام HPLC باستخدام نظام تحليل بيانات الكمبيوتر. لتحديد الحمض الأميني الموجود عند رقم بقايا معين ، تتم مقارنة مخطط الكروماتوجرام من المخلفات ذات الأهمية مع مخطط الكروماتوجرام من المخلفات السابقة عن طريق تراكب أحدهما فوق الآخر. من هذا ، يمكن تحديد الحمض الأميني لبقايا معينة (انظر الشكل 3). تتكرر هذه العملية بالتتابع لتوفير تسلسل N-terminal للبروتين / الببتيد.

    معلومات إضافية: PTH Amino Acid Analysis ، Michael W. Hunkapiller ، ABI User Bulletin Issue No. 14 ، November 18 ، 1985

    يفضل 10-100 pmols ، على الرغم من أن كمية أقل مقبولة.

    1. في 30-150 ميكرولتر من المذيبات المتطايرة مثل الماء أو الأسيتونيتريل أو البروبانول أو حمض الأسيتيك أو حمض الفورميك. الببتيد / البروتين النقي المجفف بالتجميد مقبول أيضًا.

    II. على غشاء PVDF (لا تستخدم Pall BioTrace PVDF أو نظام iBlot). يجب أن تكون العينة مركزة قدر الإمكان على غشاء PVDF (على سبيل المثال 1 & # 181g / lane). يمكن استخدام عدة نطاقات. يجب أن تكون العصابات ملطخة بـ Coomassie Blue أو Ponceau S أو Amido Black. بعد تلطيخ الغشاء المنقط ، يجب شطفه جيدًا بالماء منزوع الأيونات. يمكن تقديم الغشاء بالكامل مع تحديد الأشرطة أو قد يتم قطع الأشرطة وتقديمها.

    يجب أن تحتوي العينات السائلة على بروتين أو ببتيد واحد فقط. يجب إزالة المخازن المؤقتة ، SDS ، الأملاح ، الأحماض الأمينية ، الأمينات الأولية ، والملوثات الأخرى من عينتك. تؤثر هذه الملوثات على تفاعل تحلل Edman على الجهاز ، أو تلوث الجهاز أو تؤثر على اكتشاف الأحماض الأمينية PTH. يجب أن تحتوي العينات المقدمة على PVDF (التي تم مسحها من المواد الهلامية SDS-PAGE) على نطاقات منفصلة جيدًا لتقليل التلوث.

    نظرًا لأنه لا يمكن اكتشاف مخلفات Cys غير المعدلة ، يجب تعديل Cys قبل إرسال العينة إذا كنت ترغب في تحديد Cys. يمكن الحصول على إجراءات التعديل من منشأة البروتين.

    إذا تم حظر المحطة الأمينية ، فلا يمكن تسلسل البروتين أو الببتيد باستخدام تحلل Edman. نقوم بتنفيذ إجراءات إلغاء الحظر وسنناقش الخيارات معك في حالة الاشتباه في انسداد طرف N

    الارتباط بالجليكوزيل والتعديلات الأخرى

    قد تؤدي الأحماض الأمينية الجليكوزيلاتية والأحماض الأمينية الفسفورية إلى دورات فارغة ، أو تقليل القمم أو تغيير أوقات الاحتفاظ. يمكن التعرف على بعض هذه الأحماض الأمينية المعدلة باستخدام "تحديد الأحماض الأمينية المعدلة PTH في تحليل تسلسل البروتين" بواسطة Mark W. Crankshaw و Gregory A Grant.

    • إعداد عينة :
      • سيقوم معظم الباحثين بتشغيل عينتهم على هلام SDS-PAGE ثم طقطقة كهربائية إلى PVDF (لا تستخدم Pall BioTrace PVDF) ، وصمة عار مع Coomassie وقطع النطاق الذي يهم. يجب عليك استخدام PVDF وليس النيتروسليلوز. يمكن تحميل ممرات متعددة من البقعة على جهاز التسلسل.
      • إذا كان بإمكانك تصور العصابات على غشاء PVDF باستخدام Coomasssie ، فيجب أن تكون هناك مادة كافية للتسلسل. يمكنك إما إرسال الغشاء بالكامل مع تحديد العصابات بوضوح وسنقوم بقصها في مختبرنا أو يمكنك استئصال العصابات ذات الأهمية وإرسالها في أنبوب الطرد المركزي الصغير.
      • ستحتاج إما إلى استخدام المواد الهلامية مسبقة الصب أو ترك الجل يتبلمر طوال الليل قبل تشغيل العينة. سيساعد هذا في القضاء على أي انسداد طرفي N بسبب مادة الأكريلاميد غير المبلمرة في الجل. تأكد من استخدام الميثانول عالي الجودة أيضًا.
      • يمكن أيضًا إرسال العينات في صورة سائلة إذا كانت خالية من الأملاح والمخازن المؤقتة والأمينات وما إلى ذلك وتحتوي على بروتين واحد.
      • يمكن تنظيف العينات السائلة التي تحتوي على مخازن أو ملوثات أخرى باستخدام جهاز ABI ProSorb.
      • تحضير عينات لتسلسل البروتين: دليل الوافد الجديد ، شركة Perkin Elmer ، 1995

      مرفق الاتصال

      بريد الالكتروني:
      هاتف: (515) 294-3267
      فاكس: (515) 294-7629


      بروتين جليكوزيل

      الارتباط بالجليكوزيل هو وظيفة حاسمة للمسار الإفرازي الحيوي في الشبكة الإندوبلازمية (ER) وجهاز جولجي. ما يقرب من نصف جميع البروتينات التي يتم التعبير عنها عادةً في الخلية تخضع لهذا التعديل ، والذي يستلزم إضافة تساهمية لأجزاء السكر إلى أحماض أمينية معينة. معظم البروتينات القابلة للذوبان والمرتبطة بالغشاء المعبر عنها في الشبكة الإندوبلازمية تكون غليكوزيلاتي إلى حد ما ، بما في ذلك البروتينات المُفرزة ، والمستقبلات السطحية والروابط ، والبروتينات الموجودة في العضية. بالإضافة إلى ذلك ، فإن بعض البروتينات التي يتم تهريبها من جولجي إلى السيتوبلازم هي أيضًا جليكوزيلاتي. يمكن أيضًا معالجة الدهون والبروتيوغليكان بالجليكوزيلات ، مما يزيد بشكل كبير من عدد الركائز لهذا النوع من التعديل.

      نطاق

      يرتبط ارتباط البروتين بالجليكوزيل بوظائف متعددة في الخلية. في ER ، يتم استخدام الارتباط بالجليكوزيل لمراقبة حالة طي البروتين ، حيث يعمل كآلية لمراقبة الجودة لضمان نقل البروتينات المطوية بشكل صحيح فقط إلى Golgi. يمكن ربط شقوق السكر الموجودة على البروتينات القابلة للذوبان بمستقبلات محددة في عبر شبكة Golgi لتسهيل توصيلها إلى الوجهة الصحيحة. يمكن أن تعمل هذه السكريات أيضًا كروابط للمستقبلات الموجودة على سطح الخلية للتوسط في ارتباط الخلية أو تحفيز مسارات نقل الإشارة (1). نظرًا لأنها يمكن أن تكون كبيرة جدًا وضخمة ، يمكن أن تؤثر السكريات قليلة الكثافة على تفاعلات البروتين والبروتين من خلال تسهيل أو منع البروتينات من الارتباط بمجالات التفاعل المماثلة. لأنها محبة للماء ، يمكنها أيضًا تغيير قابلية ذوبان البروتين (2).

      توزيع

      تم العثور على البروتينات الجليكوزيلات (البروتينات السكرية) في جميع الكائنات الحية التي تمت دراستها تقريبًا ، بما في ذلك حقيقيات النوى والبكتيريا الحقيقية والأركا (3،4). تمتلك حقيقيات النوى أكبر مجموعة من الكائنات الحية التي تعبر عن البروتينات السكرية ، من الكائنات أحادية الخلية إلى الكائنات متعددة الخلايا المعقدة.

      تنوع البروتينات السكرية

      يزيد الارتباط بالجليكوزيل من تنوع البروتين إلى مستوى لا مثيل له بأي تعديل آخر بعد الترجمة. الخلية قادرة على تسهيل هذا التنوع ، لأنه يمكن تعديل كل جانب من جوانب الارتباط بالجليكوزيل تقريبًا ، بما في ذلك:

      • ارتباط الجليكوسيد—موقع الارتباط بالجليكان (قليل السكاريد)
      • تكوين جليكان—أنواع السكريات المرتبطة ببروتين معين
      • هيكل جليكان- السلاسل الممنوحة أو غير الممنوحة
      • طول الجليكان- سكريات قليلة أو طويلة السلسلة

      يُعتقد أن الارتباط بالجليكوزيل هو أكثر تعديلات ما بعد الترجمة تعقيدًا بسبب العدد الكبير من الخطوات الأنزيمية المتضمنة (5). تتضمن الأحداث الجزيئية للارتباط بالجليكوزيل ربط السكريات الأحادية معًا ، ونقل السكريات من ركيزة إلى أخرى ، وتقليم السكريات من بنية الجليكان. على عكس العمليات الخلوية الأخرى مثل النسخ أو الترجمة ، فإن الارتباط بالجليكوزيل غير مقولب ، وبالتالي ، لا تحدث كل هذه الخطوات بالضرورة خلال كل حدث ارتباط بالجليكوزيل. بدلاً من استخدام القوالب ، تعتمد الخلايا على مجموعة من الإنزيمات التي تضيف السكريات أو تزيلها من جزيء إلى آخر لتوليد البروتينات السكرية المتنوعة التي تُرى في خلية معينة. على الرغم من أنها قد تبدو فوضوية بسبب جميع الإنزيمات المعنية ، إلا أن الآليات المختلفة للارتباط بالجليكوزيل هي تفاعلات مرتبة بدرجة عالية ومتدرجة يعتمد فيها نشاط الإنزيم الفردي على اكتمال التفاعل الإنزيمي السابق. نظرًا لأن نشاط الإنزيم يختلف باختلاف نوع الخلية والمقصورة داخل الخلايا ، يمكن للخلايا تصنيع البروتينات السكرية التي تختلف عن الخلايا الأخرى في بنية الجليكان (5).

      تسمى الإنزيمات التي تنقل السكريات الأحادية أو قليلة السكاريد من الجزيئات المانحة إلى نمو سلاسل أو بروتينات السكاريد قليلة السكريات glycosyltransferases (Gtfs). لكل Gtf خصوصية لربط سكر معين من متبرع (نوكليوتيد السكر أو dolichol) إلى ركيزة ويعمل بشكل مستقل عن Gtfs الأخرى. هذه الإنزيمات واسعة النطاق ، حيث تم اكتشاف روابط جليكوسيدية في كل مجموعة وظيفية بروتينية تقريبًا ، وقد ثبت أن الارتباط بالجليكوزيل يشتمل على معظم السكريات الأحادية الشائعة إلى حد ما (6).

      تحفز Glycosidases التحلل المائي للروابط الجليكوسيدية لإزالة السكريات من البروتينات. هذه الإنزيمات ضرورية لمعالجة الجليكان في ER و Golgi ، ويظهر كل إنزيم خصوصية لإزالة سكر معين (على سبيل المثال ، مانوسيداز).

      أنواع الارتباط بالجليكوزيل

      يمكن تصنيف روابط Glycopeptide إلى مجموعات محددة بناءً على طبيعة رابطة السكر والببتيد و oligosaccharide المرتبط ، بما في ذلك الارتباط بالجليكوزيل المرتبط بـ N و O و C و glypiation و phosphoglycosylation. نظرًا لأن N- و O-glycosylation و glypiation هما أكثر أنواع الارتباط بالجليكوزيل التي يتم اكتشافها شيوعًا ، فسيتم التركيز بشكل أكبر في هذه المقالة على هذه التعديلات.

      أنواع الجليكوزيل
      N- مرتبطيرتبط Glycan بالمجموعة الأمينية من الهليون في ER
      مرتبط Oترتبط السكريات الأحادية بمجموعة الهيدروكسيل من السيرين أو الثريونين في ER و Golgi و cytosol و nucleus
      Glypiationيربط قلب الجليكان بين الفوسفوليبيد والبروتين
      سي المرتبطالمانوز يرتبط بحلقة الإندول من التربتوفان
      الارتباط بالفوسفوجليكوزيليرتبط جليكان بالسيرين عبر رابطة فوسفوديستر

      لا تقتصر البروتينات على نوع معين من الارتباط بالجليكوزيل. في الواقع ، غالبًا ما يتم معالجة البروتينات بالجليكوزيلات في مواقع متعددة بروابط جليكوسيدية مختلفة ، والتي تعتمد على عوامل متعددة بما في ذلك تلك الموضحة أدناه.

      1. توافر الانزيم

      يتم التحكم في الارتباط بالجليكوزيل عن طريق نقل البروتينات إلى مناطق ذات تركيزات مختلفة من الإنزيمات ، حيث تقوم الخلايا بحبس الإنزيمات في حجرات محددة لتنظيم نشاطها. على سبيل المثال ، بعد بروتين N-glycosylated في ER ، تحدث معالجة الجليكان بطريقة تدريجية عن طريق تهريب البروتينات إلى صهاريج Golgi المتميزة التي تحتوي على تركيزات عالية من Gtfs و glycosidases محددة.

      2. تسلسل الأحماض الأمينية

      إلى جانب متطلبات الحمض الأميني الصحيح (على سبيل المثال ، Asn لـ Ser / Thr لـ O المرتبط بـ N) ، فإن العديد من الإنزيمات لها متواليات أو أشكال متفق عليها تسمح بتكوين رابطة الجليكوسيد (6).

      3. تكوين البروتين (التوافر)

      عندما يتم تصنيع البروتينات ، فإنها تبدأ في الانطواء في هيكلها الثانوي الناشئ ، والذي يمكن أن يجعل الأحماض الأمينية المحددة غير قابلة للوصول للارتباط الجليكوسيد. وبالتالي ، يجب أن تكون الأحماض الأمينية المستهدفة متاحة بشكل توافقي لحدوث الارتباط بالجليكوزيل.


      مناقشة

      تشير نتائجنا بقوة إلى أن النزلات - جميع القردة ، وجميع القردة في إفريقيا وآسيا ، من المحتمل أن تكون عرضة للإصابة بفيروس SARS-CoV-2. هناك تحفظ كبير في تسلسل البروتين للمستقبل المستهدف ، ACE2 ، بما في ذلك التوحيد في جميع مواقع الربط الرئيسية المحددة والمختبرة. في الواقع ، حتى من بين البقايا الـ 21 المحددة في قائمتنا الكاملة لنقاط الربط المحتملة ، فإن النزلات تبقى ثابتة (الجدول التكميلي 1 والشكل التكميلي S2). تمشيا مع نتائجنا ، أظهرت دراسات العدوى أن قرود الريسوس (مكاكا مولاتا) ، قرود المكاك طويلة الذيل (M. الحزم) و vervets (كلوروسيبوس سابيوس) مسموحًا بالعدوى بواسطة SARS-CoV-2 ، واستمر في تطوير أعراض شبيهة بـ COVID-19 11،12،14،15،16. تقدم نتائجنا المستندة إلى نمذجة البروتين أخبارًا أفضل محتملة للقرود في الأمريكتين (بلاتيررين). هناك ثلاثة اختلافات في بقايا الأحماض الأمينية بين platyrrhines و catarrhines ، واثنان من هؤلاء ، H41Y و E42Q يظهران دليلًا قويًا على حدوث تغييرات مؤثرة. تم تصميم هذه التغييرات في الأحماض الأمينية لتقليل ألفة الارتباط بين SARS-CoV-2 و ACE2 بواسطة ca. 400 ضعف. التحليل السريري الأخير للتساقط الفيروسي ، وفيروسات الدم ، والتشريح المرضي في النزلات (المكاك) مقابل البلاتيررين (القرد ، كاليثريكس جاكوس) تظهر الاستجابات للتلقيح بـ SARS-CoV-2 عرضًا أكثر حدة لأعراض المرض في السابق ، مما يدعم بقوة نتائجنا 16. من المتوقع حدوث حساسية منخفضة مماثلة بالنسبة للحيوانات الصغيرة ، واثنين من الليمورات الخمسة واللوريسويدات (strepsirrhines). الأمر المثير للقلق هو أن ثلاثة من الليمورات التي تم تحليلها والتي تمتد عبر سلالات متباينة - سيفاكا كوكريل ، وآي آي ، والليمور الأسود ذو العين الزرقاء - تشبه إلى حد كبير النزلات في مواقع الربط المهمة ، بما في ذلك امتلاك متغير المخلفات عالية الخطورة في الموقع 41 ، وعلى هذا النحو من المتوقع أيضًا أن يكون عرضة للإصابة. ومع ذلك ، فهذه هي النتائج المتوقعة فقط بناءً على بقايا الأحماض الأمينية ونماذج تفاعل البروتين والبروتين. نحن نحث على توخي الحذر الشديد في استخدام تحليلاتنا كأساس لسياسات الاسترخاء فيما يتعلق بحماية platyrrhines أو tarsiers أو أي strepsirrhines. يمكن أن يحدث التقييم التجريبي لتفاعلات البروتين الاصطناعي الآن في المختبر ، على سبيل المثال 41 ، ويجب البحث عن تأكيد لتوقعاتنا النموذجية قبل الوصول إلى أي استنتاجات مؤكدة.

      يبدو أن الأدلة الناشئة في النماذج التجريبية للثدييات تدعم نتائجنا ، أظهرت كل من الكلاب والقوارض والخنازير والقطط بعض القابلية للإصابة بـ SARS-CoV-2 ولكنها أظهرت تباينًا في شدة المرض وعرضه ، بما في ذلك عبر الدراسات 39،42. قد تكون البدائل في مواقع الربط واقية جزئيًا على الأقل من COVID-19 في هذه الثدييات. على سبيل المثال ، تشير الأدلة التجريبية المحدودة حتى الآن إلى أنه في حين أن القطط - التي لديها نفس البقايا مثل البشر في الموقع 34 - ليست مصحوبة بأعراض قوية ، فإنها تظهر آفات في الرئة ، بينما الكلاب - التي لديها بديل في هذا الموقع - لا تظهر 39. تختلف بقايا الأحماض الأمينية في الموقع 24 عن الرئيسيات في جميع أنواع الثدييات الأخرى التي تم فحصها. ومع ذلك ، تشير نماذجنا إلى أن المخلفات المتغيرة قد تمنح تخفيضات طفيفة نسبيًا في تقارب الربط. قد تؤثر مصادر الاختلاف الأخرى على استقرار بروتين ACE2 34. تتوافق نتائجنا أيضًا مع التقارير السابقة التي آيس 2 التنوع الجيني أكبر بين الخفافيش مما لوحظ بين الثدييات المعرضة للفيروسات من نوع السارس. تم اقتراح هذا الاختلاف للإشارة إلى أن أنواع الخفافيش قد تعمل كمستودع لفيروسات SARS-CoV أو أسلافها 38. ومن المثير للاهتمام ، أن جميع أنواع الخفافيش التي فحصناها باستثناء نوعين لها متغير وقائي مفترض ، H41. بالإضافة إلى ذلك ، تدعم نتائج تحليل موقع فرع codeml الخاص بنا النتائج السابقة لـ آيس 2 في الخفافيش التي تخضع للاختيار الإيجابي ، بما في ذلك المواقع ضمن مجال ربط SARS-CoV و SARS-CoV-2 43 ، والتي قد تكون دليلاً على التطور المشترك للفيروس المضيف. المواقع التي تظهر أدلة على الاختيار الإيجابي داخل النزلات آيس 2 لم تكن التسلسلات في مواقع ربط CoV المعروفة أو بالقرب منها (الجدول 3 والشكل 1).اثنان (بقايا 653 ، 658) يقعان داخل موقع الانقسام (المخلفات 652-659) المستخدمة بواسطة sheddase ADAM17 ، المعروف بالتفاعل مع ACE2 44. ومع ذلك ، لم تكن أي من البقايا قيد الاختيار هي الأحماض الأمينية المستهدفة بواسطة ADAM17 45 ، مما يترك الأهمية الوظيفية للتطور في هذه المواقع غير مؤكدة. هناك حاجة إلى مزيد من الدراسات السريرية والمخبرية لفهم ديناميكيات العدوى بشكل كامل.

      هناك عدد من المحاذير المهمة لدراستنا. أولاً ، تستند جميع تنبؤاتنا إلى تفسيرات الجينات وتسلسل الأحماض الأمينية الناتجة ، بدلاً من الاعتماد على التقييم المباشر للاستجابات الفردية للعدوى المستحثة. ومع ذلك ، فإن النمط العام لنتائجنا تؤكده دراسات العدوى على عدد قليل من الأنواع التي تستخدم كنماذج طبية حيوية. حتى الآن ، أظهرت جميع أنواع النزلات التي تم اختبارها من خلال دراسات العدوى ، بما في ذلك قرود المكاك ريسوس ، وقرود المكاك طويلة الذيل ، وقرود الفرفت 12،16،46 أعراضًا شبيهة بـ COVID-19 استجابةً للعدوى ، بما في ذلك الرئة الكبيرة وآفات الأعضاء الأخرى 16 و العواصف الخلوية 12. في المقابل ، لم تظهر قردات القرد (marmosets) أعراضًا كبيرة استجابةً للعدوى 16. بينما تدعم هذه النتائج النتائج التي توصلنا إليها وتتحقق من صحتها استنادًا إلى تفسير تسلسل ACE2 ، فإن عدد أنواع الرئيسيات التي يمكن اختبارها مباشرة من خلال دراسات العدوى سيقتصر على عدد قليل فقط. تعزز دراستنا هذه الصورة ، من خلال السماح بإجراء استنتاجات عبر إشعاع الرئيسيات ، مدعومة بدراسات العدوى المنشورة على عدد قليل من أنواع النماذج المستهدفة. بعض نتائجنا ، مثل الحفظ الموحد لـ آيس 2 يجب أن تعطي مواقع الربط بين النزلات ، المدعومة بقابلية عالية واضحة للإنسان ونزلات أخرى للإصابة بـ SARS-CoV-2 ، درجة جيدة من الثقة بمستويات عالية من المخاطر. بالنظر إلى البقايا المتطابقة للبشر في القردة والقرود الأخرى في آسيا وإفريقيا في المواقع المستهدفة ، يبدو من غير المحتمل أن مستقبلات ACE2 وبروتينات SARS-CoV-2 لن ترتبط بسهولة. تعتمد نتائجنا للأنواع الأخرى على النمذجة ، وبالتالي يجب التعامل معها بحذر أكبر. يتضمن هذا جميع تفسيرات قابلية التأثر بالبلاتيررينات والستريبسيرين ، حيث تم تقدير تأثيرات الاختلافات البقايا على الصلات الملزمة بناءً على نمذجة تفاعل البروتين والبروتين. تحذير آخر هو أننا قمنا بنمذجة التفاعلات فقط في مواقع الربط ، وليس التنبؤات بناءً على تباين تسلسل المخلفات الكامل. قد تظل البقايا التي ليست على اتصال مباشر تؤثر على الارتباط التفاضلي. العوامل الأخرى ، بما في ذلك البروتياز الضروري للدخول الفيروسي ، والأهداف الفيروسية الأخرى ، قد تؤثر أيضًا على قابلية المرض والاستجابات 34. بشكل عام ، إذا تم الالتزام بالمبدأ الوقائي ، فإن نتائجنا التي تسلط الضوء على مخاطر أعلى لبعض الأنواع يجب أن تؤخذ بجاذبية أكبر من نتائجنا التي تتنبأ بمخاطر أقل محتملة للآخرين. قيد آخر لدراستنا هو أننا نظرنا إلى 29 نوعًا فقط من الرئيسيات ، وإن كان ذلك بنطاق تصنيفي واسع. تحليل الأنواع الإضافية مهم ، خاصة بين أنواع strepsirrhine ، حيث تغطيتنا ضئيلة نسبيًا. على وجه الخصوص ، تتداخل البقايا في مواقع الربط المهمة في تسلسل سيفاكا Coquerel ، و aye-aye ، و الليمور الأسود ذو العين الزرقاء مع تلك الموجودة في النزلات ، مما يشير إلى أن العديد من الليمورات قد تكون معرضة بشكل كبير ونحن نؤكد على الحاجة إلى تقييم تنوع أوسع من أنواع الليمور. علاوة على ذلك ، نحن نفحص فردًا واحدًا فقط لكل نوع ، وينبغي النظر في التباين غير المحدد عبر السكان ، ومع ذلك ، تشير الدراسات حول تباين ACE2 داخل النوع مع البشر وقرود الفرفت إلى أن متغيرات ACE2 منخفضة التردد 47 ، 48 ، 49. أخيرًا ، من المهم أيضًا أن نتذكر أن دراستنا تقيم فقط إمكانية الارتباط الأولي للفيروس بالموقع المستهدف. قد تختلف عواقب العدوى بشكل كبير بناءً على البروتياز الخاص بالأنواع والمتغيرات الجينية والتمثيل الغذائي واستجابات الجهاز المناعي. في البشر ، يمكن أن يؤدي تطور COVID-19 إلى عاصفة خلوية مؤيدة للالتهابات من فرط الالتهاب ، مما قد يؤدي إلى بعض الآثار الأكثر خطورة للعدوى. ومع ذلك ، يتضح من مئات الآلاف من الوفيات والإغلاق العالمي أن البشر معرضون بشدة لعدوى السارس- CoV-2 ، وتشير نتائجنا إلى أن جميع القرود والقردة في إفريقيا وآسيا معرضون للإصابة بالمثل.

      لا توجد الآن العديد من أنواع الرئيسيات المهددة بالانقراض إلا في أعداد صغيرة جدًا من السكان 53. على سبيل المثال ، يُعتقد أنه لم يتبق سوى حوالي 1000 غوريلا جبلية في نطاقها الكامل 54. مع هذا العدد القليل من السكان ، فإن ظهور مرض جديد شديد العدوى يثير قلقًا خطيرًا. إعادة فتح الوصول إلى مجموعات القردة العليا المألوفة لأغراض السياحة ، والتي قد تكون حاسمة للاقتصادات المحلية 55 ، قد تكون محفوفة بالمشاكل. توصي أفضل ممارسات IUCN بأن يبقى السائحون على بعد 7 أمتار على الأقل من القردة العليا 56 ، ولكن في الممارسة العملية ، يقترب جميع السياح تقريبًا من ذلك - على سبيل المثال ، متوسط ​​المسافة التي يقطعها السائحون عن الغوريلا الجبلية في متنزه بويندي الوطني غير القابل للاختراق في أوغندا 2.76 م 57 فقط. قد يتطلب الأمر بذل جهود متضافرة من قبل جميع أصحاب المصلحة لمحاولة تجنب إدخال فيروس SARS-CoV-2 في مجموعات الرئيسيات البرية 10. تشمل التدابير الأخيرة التي اقترحها الاتحاد الدولي لحفظ الطبيعة للباحثين والقائمين على رعاية مجموعات القردة العليا ما يلي: التأكد من أن جميع الأفراد يرتدون ملابس نظيفة وأحذية مطهرة توفر مرافق لغسل اليدين تتطلب ارتداء قناع وجه جراحي من قبل أي شخص قادم على بعد 10 أمتار من القردة العليا. الأشخاص الذين يحتاجون إلى السعال أو العطس بشكل مثالي يغادرون المنطقة ، أو على الأقل يسعلون / يعطسون في صميم مرفقيهم ويفرضون الحجر الصحي لمدة 14 يومًا لجميع الأشخاص الذين يصلون إلى مناطق القردة العليا الذين سيقتربون منهم بشكل متكرر 17. يجب أيضًا اتباع "إرشادات أفضل الممارسات للمراقبة الصحية والسيطرة على الأمراض في تجمعات القردة العليا" الصادرة عن الاتحاد الدولي لحفظ الطبيعة والموارد الطبيعية (IUCN) 58.

      تشير نتائجنا إلى أن العشرات من أنواع الرئيسيات غير البشرية ، بما في ذلك جميع أقرب أقربائنا ، من المرجح أن تكون شديدة التأثر بعدوى السارس- CoV-2 ، ومعرضة لتأثيراته. قد تكون هناك حاجة لاتخاذ إجراءات رئيسية للحد من تعرض العديد من مجموعات الرئيسيات البرية للإنسان. ومن المحتمل أن يتطلب ذلك مساهمة منسقة من جميع أصحاب المصلحة ، بما في ذلك المجتمعات المحلية ، والوكالات الحكومية الدولية والوطنية ، والمنظمات غير الحكومية للحفظ والتنمية ، والأكاديميين والباحثين. في حين أن تركيز الكثيرين في هذا الوقت ينصب بحق على التخفيف من الدمار الإنساني لفيروس كوفيد -19 ، فمن واجبنا أيضًا التأكد من أن أقرب أقربائنا الأحياء لا يعانون من عدوى مدمرة والمزيد من الانخفاض في عدد السكان استجابةً لأي سبب آخر من صنع الإنسان. نكبة.


      المواد والأساليب

      المحاذاة الهيكلية

      تم تصميم المجال التحفيزي لـ CCP3 بمساعدة خادم RaptorX (Källberg وآخرون.، 2012) واستخدام الهياكل المتاحة لثلاثة من نقاط التحكم الحرجة كقوالب من P. الزنجارية (PDB 4a37 أوتيرو وآخرون., 2012), B. mallei (PDB 3k2k) و S. denitrificans (PDB 3l2n). تم اشتقاق مخططات Ramachandran للنماذج المقترحة للتحقق من الكيمياء الفراغية المناسبة للمخلفات ، وتم التحقق من جودة النموذج المحلي والشامل باستخدام Verify3D (Bowie وآخرون.، 1990 لوثي وآخرون.، 1992) و Prosa-web (Sippl ، 1993 Wiederstein and Sippl ، 2007). تم دعم Arg في الموضع 255 من خلال محاذاة التسلسل القائمة على الهيكل التي أجراها RaptorX ، I-TASSER (Zhang ، 2008 Roy وآخرون.، 2010) ، GalaxyWEB (Ko وآخرون.، 2012) ، و PDBsum (Laskowski ، 2001 بيانات غير منشورة).

      زراعة الخلايا ، تعداء الخلايا ، والتكتل المناعي

      تم الحفاظ على خلايا HEK293T الملتصقة في ظل ظروف قياسية وتم نقلها (انظر الجدول التكميلي S1 للبلازميدات) باستخدام البولي إيثيلين الخطي (PEI Polysciences ، Eppelheim ، ألمانيا) بنسبة 1: 3 DNA: PEI. تم جمع الخلايا بعد 48 ساعة ، وتم فصلها في 100 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، و 150 ملي مول كلوريد الصوديوم ، و 0.1٪ NP-40 مكملًا بـ 1/1000 من مجموعة كوكتيل مثبط البروتياز الخالي من EDTA (Calbiochem ، دارمشتات ، ألمانيا) ، وطردها لمدة 10 دقائق ، 15000 × ز عند 4 درجات مئوية. تم إجراء SDS – PAGE والتكتل المناعي على أغشية النيتروسليلوز (EMD Millipore ، Darmstadt ، ألمانيا) باستخدام البروتوكولات القياسية. تم الكشف عن البروتينات باستخدام أجسام مضادة أولية مختلفة (الجدول التكميلي S2) وتم تصورها باستخدام الأجسام المضادة الثانوية المسمى بيروكسيديز الفجل ، تليها التلألؤ الكيميائي (مجموعة اكتشاف لطخة غربية ECL GE Healthcare ، Velizy-Villacoublay ، فرنسا).

      تثبيت الخلايا والكيمياء المناعية

      من أجل التألق المناعي ، تم زرع خلايا HEK293T في أطباق المزرعة وتم نقلها بعد 24 ساعة من الطلاء ، كما هو موضح من قبل. بعد 12 ساعة ، تم تجريب الخلايا وطليها على أغطية زجاجية معقمة في ستة ألواح (Nunc ، Villebon sur Yvette ، فرنسا) وحضنت لمدة 24 ساعة قبل التثبيت. تم تطبيق طريقة التثبيت للحفاظ على هياكل الأنابيب الدقيقة (Bell and Safiejko-Mroczka ، 1995). باختصار ، تم تحضين الخلايا لمدة 10 دقائق عند درجة حرارة الغرفة في 1 ملي مولار ديثيوبيس (بروبيونات سوكسينيميديل) (DSP Thermo Scientific ، Rockford ، IL) في محلول ملح متوازن من Hanks ، متبوعًا بـ 10 دقائق من الحضانة مع 1 ملي DSP في المخزن المؤقت لتثبيت الأنابيب الدقيقة (MTSB). تم غسل الخلايا في محلول ملحي بالفوسفات (PBS) لمدة 5 دقائق مع 0.5 ٪ Triton X-100 (Fluka ، Saint-Quentin Fallavier ، فرنسا) في MTSB قبل التثبيت مع 4 ٪ بارافورمالدهيد (PFA) في MTBS. تبع هذه الخطوة غسل لمدة 5 دقائق في برنامج تلفزيوني ، و 5 دقائق في 100 ملي جليكاين في برنامج تلفزيوني ، وغسل نهائي في برنامج تلفزيوني.

      بعد التثبيت ، تم غسل الخلايا لمدة 5 دقائق في برنامج تلفزيوني يحتوي على 0.1 ٪ Triton X-100 ثم حضنت مع الأجسام المضادة الأولية في PBS ، و 0.1 ٪ Triton X-100 ، و 2 ٪ من ألبومين مصل البقر (Sigma-Aldrich ، Villebon sur Yvette ، فرنسا ) لمدة 1 ساعة في درجة حرارة الغرفة. تم غسل الخلايا التالية أربع مرات باستخدام PBS و 0.1٪ Triton X-100 ، تليها حضانة لمدة ساعة واحدة باستخدام مضاد للأرنب Alexa Fluor 568 ومضاد للفأر Alexa Fluor 350 (Invitrogen ، Saint Aubin ، فرنسا) في PBS و 0.1٪ Triton إكس 100. تم إجراء عمليات الغسيل قبل تركيب الأغطية باستخدام ProLong Gold (Life Technologies ، Saint Aubin ، فرنسا).

      استخراج الحمض النووي الريبي والكمي PCR

      تم تشريح الأعضاء من الفئران التي يبلغ عمرها من 4 إلى 5 أسابيع وتم تجميدها على الفور في النيتروجين السائل. تم الحفاظ على خلايا IMCD3 في ظل ظروف قياسية وتم تجويع المصل لمدة 3 و 5 د للحث على التكوّن الهدبي. تم إجراء استخراج الحمض النووي الريبي باستخدام كاشف TRIzol (تقنيات الحياة) ، باتباع تعليمات الشركة الصانعة. تم تحديد تركيز وجودة الحمض النووي الريبي ، وتم تطبيق qRT-PCR في ظل ظروف قياسية باستخدام مجموعة SYBR Green Master Mix على نظام اكتشاف التسلسل ABI Prism 7900 (PerkinElmer-Cetus ، Courtaboeuf ، فرنسا) باستخدام مواد أولية محددة (الجدول الإضافي S4).

      ابحث في قاعدة البيانات عن البروتينات المنتهية بالامتدادات الحمضية الأمينية الحمضية

      تم إجراء بحث المعلومات الحيوية عن البروتينات المعرضة لأن تكون ركائز لنقاط التحكم الحرجة باستخدام أداة ScanProsite (دي كاسترو وآخرون.، 2006). تم إجراء البحث عن البروتينات الحمضية الكلية باستخدام النمط [ED] (ن) & GT ، أين ن يمثل عدد المخلفات الحمضية المتتالية عند الطرف C للبروتين. بحثنا عن C-terminal تمتد من اثنين وأطول. تم تحديد العدد الإجمالي للبروتينات مع عدد معين من الأحماض الأمينية الحمضية في الطرف C من H. العاقل, M. العضلات, D. melanogaster، و C. ايليجانس أصناف من قاعدة بيانات 2014_05 UniProtKB / Swiss-Prot ، باستخدام الإعدادات الافتراضية. متغيرات لصق غير مسموح بها. تم تكرار نفس البحث عن ذيول C- التي تحتوي فقط على بقايا الجلوتامات.

      جيل ال Agbl2 KO ، Agbl3 KO و Agbl2/Agbl3 الفئران مزدوجة KO

      خطوط الماوس الطافرة الشرطية لـ Agbl2 (على إكسون 9) ولأجل Agbl3 (على exons 7 + 8) في معهد Mouse Clinical Institute (MCI ، Illkirch ، فرنسا). تم إنشاء ناقلات الاستهداف على النحو التالي. 5 ′ (4.5 كيلو بايت لـ Agbl2 3.5 كيلو بايت من أجل Agbl3) ، 3 (3.5 كيلو بايت لـ CCP2 4.7 كيلو بايت لـ CCP3) ، و inter-loxP (1.1 كيلو بايت لـ Agbl2 3.0 كيلو بايت من أجل Agbl3) تم تضخيم شظايا PCR واستنساخها بشكل متسلسل في ناقل ملكية MCI يحتوي على مواقع LoxP وشريط جديد محاط بمواقع استهداف التعرف على Flippase (الشكل التكميلي S6). تم إمداد البناء الخطي بالكهرباء في خلايا جذعية جنينية (ES) للماوس 129S2 / SvPas. بعد الاختيار ، تم تحديد الحيوانات المستنسخة المستهدفة بواسطة PCR باستخدام الاشعال الخارجي وتم تأكيدها بشكل أكبر بواسطة لطخة جنوبية مع تحقيقات خارجية 5 و 3. تم حقن نسختين إيجابيتين من ES في الكيسات الأريمية ، وأعطت الكيميرات الذكرية المشتقة انتقال السلالة الجرثومية. تم إجراء استئصال الكاسيت المقاوم للنيومايسين في الجسم الحي عن طريق تكاثر الكيميرات بخط فاصل Flp (خلفية وراثية C57BL / 6N FLP تحت مروج ACTB). تم فصل الجينات المحورة Flp عن طريق تربية أول فئران سلالة جرثومية بحيوان من النوع البري C57BL / 6N. لتوليد Agbl2 KO و Agbl3 الفئران KO ، Agbl2 و Agbl3 تم عبور الفئران المصابة بالفلوكس مع الفئران المعدلة وراثيا التي تعبر عن إعادة التركيب الكيميائي لـ Cre تحت سيطرة محفز الفيروس المضخم للخلايا.

      ال Agbl2 / Agbl3 تم بعد ذلك إنشاء الفئران المزدوجة KO عن طريق عبور الفئران أحادية KO. تم تحليل الحمض النووي الجيني المعزول من قصاصة ذيل الفأر بواسطة تفاعل البوليميراز المتسلسل.

      تم التنميط الجيني للفئران بواسطة PCR وفقًا لبروتوكولات MCI باستخدام GoTag polymerase (Promega ، Charbonnieres ، France) و 33 دورة تضخيم. تم استخدام المجموعات التالية المكونة من ثلاثة أزواج أولية لتحديد الأنماط الجينية.

      CCP2_Ef: CATCCTTAGCAACTCTCCCGATGCCC ، CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC ، CCP2_Lr: AGCTGCCTGCTACAGCAAACGGG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC ، CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP3_Ef: CCTCAAAACCACTGACCATCTAGACAGCC ، CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG ، CCP3_Lr: CCCCAGGAACTTTGACCCTTTGTGTGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG ، CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      التجارب على الحيوانات

      البرية من النوع C57BL / 6N ، Agbl2 KO ، Agbl3 KO و Agbl2 / Agbl3 تم إيواء الفئران المزدوجة KO في ظروف خالية من مسببات الأمراض المحددة في منشأة حيوانية في معهد كوري. تم الحفاظ على الحيوانات بإمكانية الوصول إلى الغذاء والماء بالشهرة في غرفة مستعمرة تم الاحتفاظ بها في درجة حرارة ثابتة (19-22 درجة مئوية) ورطوبة (40-50٪) عند دورات إضاءة / مظلمة لمدة 12 ساعة. تم تنفيذ جميع الإجراءات التجريبية وفقًا لإرشادات الجماعة الأوروبية (86/609 / EEC) واللجنة الوطنية الفرنسية (87/848) لرعاية واستخدام حيوانات المختبر.


      على أي بقايا أحماض أمينية تعمل الـ SDS؟ - مادة الاحياء

      سلوك القاعدة الحمضية للأحماض الأمينية

      تبحث هذه الصفحة في ما يحدث للأحماض الأمينية أثناء تغيير الأس الهيدروجيني عن طريق إضافة الأحماض أو القلويات إلى محاليلها.

      من أجل التبسيط ، تنظر الصفحة فقط إلى الأحماض الأمينية التي تحتوي على أحماض أمينية مفردة2 مجموعة ومجموعة واحدة COOH.

      الأحماض الأمينية zwitterions

      Zwitterions في محاليل الأحماض الأمينية البسيطة

      يحتوي الحمض الأميني على مجموعة أمين أساسية ومجموعة حمض الكربوكسيل الحمضي.

      يوجد انتقال داخلي لأيون الهيدروجين من مجموعة -COOH إلى -NH2 المجموعة لتترك أيونًا بشحنة سالبة وشحنة موجبة.

      وهذا ما يسمى ب زويتيريون.

      هذا هو الشكل الذي توجد به الأحماض الأمينية حتى في الحالة الصلبة. إذا قمت بإذابة الحمض الأميني في الماء ، فإن المحلول البسيط يحتوي أيضًا على هذا الأيون.

      Zwitterion هو مركب بدون شحنة كهربائية عامة ، ولكنه يحتوي على أجزاء منفصلة مشحونة سالبة وإيجابية.

      إضافة قلوي لمحلول الأحماض الأمينية

      إذا قمت بزيادة الرقم الهيدروجيني لمحلول حمض أميني عن طريق إضافة أيونات الهيدروكسيد ، تتم إزالة أيون الهيدروجين من -NH3 + المجموعة.

      يمكنك إظهار أن الحمض الأميني موجود الآن باستخدام أيون سالب الكهربائي.

      في أبسط أشكاله ، يمكن أن يتكون الرحلان الكهربائي فقط من قطعة من ورق الترشيح المبلل على شريحة مجهرية مع مشبك تمساح في كل طرف متصل بالبطارية. توضع قطرة من محلول الأحماض الأمينية في وسط الورقة.

      على الرغم من أن محلول الأحماض الأمينية عديم اللون ، إلا أنه يمكن العثور على موضعه بعد فترة من خلال رشه بمحلول نينهيدرين. إذا تم ترك الورق يجف ثم تم تسخينه برفق ، يظهر الحمض الأميني كبقعة ملونة.

      يمكن العثور على الحمض الأميني للانتقال نحو القطب الموجب (القطب الموجب).

      إضافة حمض إلى محلول الأحماض الأمينية

      إذا قمت بتقليل الأس الهيدروجيني عن طريق إضافة حمض إلى محلول حمض أميني ، فإن -COO - جزء من zwitterion يلتقط أيون الهيدروجين.

      هذه المرة ، أثناء الرحلان الكهربائي ، سيتحرك الحمض الأميني نحو الكاثود (القطب السالب).

      تحويل الأس الهيدروجيني من طرف إلى آخر

      لنفترض أنك بدأت بالأيون الذي أنتجناه للتو في ظروف حمضية وقمت بإضافة القلويات إليه ببطء.

      يحتوي هذا الأيون على اثنين من الهيدروجين الحمضي - أحدهما في مجموعة COOH والآخر في NH -NH3 + المجموعة.

      الأكثر حمضية من هذه هي تلك الموجودة في المجموعة -COOH ، وبالتالي يتم إزالتها أولاً - وتعود إلى zwitterion.

      لذلك عندما تضيف الكمية الصحيحة من القلويات ، فإن الحمض الأميني لم يعد له صافي شحنة موجبة أو سالبة. هذا يعني أنه لن يتحرك نحو القطب السالب أو الأنود أثناء الرحلان الكهربائي.

      يُعرف الرقم الهيدروجيني الذي يحدث عنده هذا النقص في الحركة أثناء الرحلان الكهربائي باسم نقطة متساوية الكهرباء من الأحماض الأمينية. هذا الرقم الهيدروجيني يختلف من الأحماض الأمينية إلى الأحماض الأمينية.

      إذا واصلت إضافة أيونات الهيدروكسيد ، فستحصل على التفاعل الذي رأيناه بالفعل ، والذي يتم فيه إزالة أيون الهيدروجين من -NH3 + المجموعة.

      ملحوظة: ربما كنت تتوقع أن تكون نقطة تساوي الكهرباء عند الرقم الهيدروجيني 7 - عندما لا يكون المحلول حمضيًا ولا قلويًا. في الواقع ، النقطة المتساوية للكثير من الأحماض الأمينية تدور حول الرقم الهيدروجيني 6. إن شرح سبب عدم وجوده عند الرقم الهيدروجيني 7 هو أمر طويل جدًا ومن المؤكد تقريبًا أنه يتجاوز ما ستحتاج إليه بالنسبة للمستوى A بالمملكة المتحدة (أو ما يعادله). إذا كنت مهتمًا ، فستتم مناقشة المشكلة في أسفل هذه الصفحة.

      يمكنك بالطبع عكس العملية برمتها عن طريق إضافة حمض إلى الأيون الذي انتهينا منه للتو.

      يحتوي هذا الأيون على مجموعتين أساسيتين - ال -NH2 المجموعة و- COO- المجموعة. إن- NH2 المجموعة هي القاعدة الأقوى ، وبالتالي تلتقط أيونات الهيدروجين أولاً. هذا يقودك إلى zwitterion مرة أخرى.

      . . . وبالطبع ، يمكنك الاستمرار عن طريق إضافة أيون الهيدروجين إلى المجموعة -COO.

      لماذا لا تكون النقطة المتساوية الكهربية للحمض الأميني عند الرقم الهيدروجيني 7؟

      تحذير: إذا كنت تدرس منهجًا دراسيًا في المملكة المتحدة ، فمن غير المرجح أن تحتاج إلى هذا لأغراض الاختبار. تم تضمينه من أجل الفائدة فقط - ربما يمكنك تجاهله بأمان. تحقق من المنهج الدراسي والأوراق السابقة. إذا لم تكن قد حصلت على هذه ، فاتبع هذا الرابط لمعرفة كيفية الحصول عليها.

      عندما يذوب حمض أميني في الماء ، يكون الوضع أكثر تعقيدًا قليلاً مما نتخيله عند هذا المستوى. يتفاعل zwitterion مع جزيئات الماء - بمثابة حمض وقاعدة.

      إن- NH3 + المجموعة حمض ضعيف وتتبرع بأيون الهيدروجين لجزيء الماء. لأنه ليس سوى حمض ضعيف ، فإن موضع التوازن سيكون على اليسار.

      تعتبر المجموعة -COO - قاعدة ضعيفة وتأخذ أيون الهيدروجين من جزيء الماء. مرة أخرى ، يكمن التوازن إلى اليسار.

      عندما تذوب حمض أميني في الماء ، يحدث كلا التفاعلين.

      مواضع الاتزان غير متطابقة - فهي تختلف حسب تأثير مجموعة & quotR & quot. من الناحية العملية ، بالنسبة للأحماض الأمينية البسيطة التي تحدثنا عنها ، فإن موضع التوازن الأول يقع أبعد قليلاً عن اليمين من الثاني.

      هذا يعني أنه سيكون هناك المزيد من الأيون السالب من الحمض الأميني في المحلول أكثر من الموجب.

      في هذه الظروف ، إذا أجريت رحلانًا كهربائيًا على المحلول غير المعدل ، فسيكون هناك انجراف طفيف للحمض الأميني نحو القطب الموجب (الأنود).

      لإيقاف ذلك ، تحتاج إلى تقليل كمية الأيونات السالبة بحيث تكون تركيزات الأيونات متطابقة. يمكنك القيام بذلك عن طريق إضافة كمية صغيرة جدًا من الحمض إلى المحلول ، وتحريك موضع التوازن الأول إلى اليسار.

      عادة ، يجب خفض الأس الهيدروجيني إلى حوالي 6 لتحقيق ذلك. بالنسبة للجليسين ، على سبيل المثال ، تكون النقطة الكهروضوئية هي درجة الحموضة 6.07 للألانين و 6.11 وللسيرين 5.68.

      ملحوظة: أحتاج إلى التأكيد مرة أخرى على أن هذه الأرقام (والحجج) تثبت فقط حيث يوجد واحد فقط - NH2 المجموعة ومجموعة واحدة COOH في الأحماض الأمينية. تختلف النقاط المتساوية تمامًا إذا كان الجزيء يحتوي على ثاني أكسيد النيتروجين2 أو مجموعة COOH.

      أسئلة لاختبار فهمك

      إذا كانت هذه هي المجموعة الأولى من الأسئلة التي أجريتها ، فيرجى قراءة الصفحة التمهيدية قبل البدء. ستحتاج إلى استخدام زر "BACK BUTTON" الموجود في متصفحك للعودة إلى هنا بعد ذلك.


      الأحماض الأمينية العطرية

      يمكن تصنيع الأحماض الأمينية العطرية ، التربتوفان ، فينيل ألانين ، والتيروزين بدءًا من جزيئين بسيطين - PEP و erythrose-4-phosphate (الشكل 6.145). جميع الأحماض الأمينية العطرية الثلاثة هي أيضًا مصادر مهمة للهرمونات ، والناقلات العصبية ، وحتى صبغة الجلد الميلانين.

      توليف التربتوفان

      حمض أميني بروتيني مع أكبر مجموعة R ، التربتوفان هو حمض أميني أساسي يتميز هيكليًا بمجموعته من الإندول. يتكون الحمض الأميني في البكتيريا والنباتات من حمض الشيكيميك أو أنثرانيلات ويستخدم السيرين في تركيبه.

      كما أن إريثروز -4 فوسفات وفسفينول بيروفات (PEP) بمثابة لبنات بناء من التربتوفان. يظهر مسار تركيبها في الأشكال من 6.146 إلى 6.148.

      يتم ربط إريثروز-4-فوسفات وفسفينول بيروفات (PEP) وبعد ذلك ، بعد تحلل مائي واحد ، تجفيف واحد ، أكسدة واحدة واختزال واحد ، المنتج هو حمض شيكيميك (الشكل 6.147).

      يتم تحويل حمض الشيكيميك إلى حمض الكوريزميك في ثلاث خطوات ، كما هو موضح في الشكل 6.147. أخيرًا ، يظهر تخليق التربتوفان من حمض الكوريزميك في الشكل 6.148.

      يحدث تنظيم تخليق التربتوفان في البكتيريا جزئيًا عبر عملية تسمى التوهين تعمل من خلال مشغل trp. في هذه الآلية ، تؤدي المستويات المنخفضة من التربتوفان إلى إبطاء حركة الريبوسوم (والترجمة) من خلال الأوبرا. هذا مهم بشكل خاص لأن البكتيريا يمكن أن تحدث نسخًا وترجمة في وقت واحد. يسمح التباطؤ في الترجمة بسبب انخفاض مستويات التربتوفان بتثبيط آلية إنهاء النسخ. نظرًا لأن الترجمة تتباطأ فقط عندما يكون هناك نقص في التريبتوفان ، يحدث الإنهاء المبكر للنسخ عندما يكون التربتوفان وفيرًا (انظر أيضًا هنا).

      إلى جانب أهميته في صنع البروتينات ، يعتبر التربتوفان مقدمة مهمة للسيروتونين (الناقل العصبي) والميلاتونين (الهرمون) والنياسين (فيتامين) والأوكسين (الهرمون النباتي). يظهر المساران المؤديان من التربتوفان إلى ثلاثة من هذه الجزيئات في الشكل 6.149.

      الميلاتونين مركب مصنوع من التربتوفان الموجود في مجموعة واسعة من الأنظمة البيولوجية ، بما في ذلك النباتات والحيوانات والفطريات والبكتيريا. في الحيوانات ، يعمل كهرمون لتزامن إيقاع الساعة البيولوجية ، مما يشير إلى بداية الظلام كل يوم. له تأثيرات على توقيت النوم ، والتأثيرات الموسمية ، ويمكن أن يؤثر على ضغط الدم ، من بين الظواهر الفسيولوجية الأخرى. يمكنه عبور أغشية الخلايا ، وكذلك الحاجز الدموي الدماغي. الميلاتونين هو مضاد قوي للأكسدة ويوفر وظائف وقائية للأحماض النووية. يستخدم أحيانًا للمساعدة في علاج اضطرابات النوم. أشارت بعض التقارير إلى أن الأطفال المصابين بالتوحد لديهم مسارات غير طبيعية للميلاتونين مع انخفاض مستويات الهرمون.

      يتأثر إنتاج الميلاتونين بالضوء الأزرق وقد يكون مرتبطًا باضطرابات النوم للأشخاص الذين يستخدمون شاشات الكمبيوتر بعد حلول الظلام. للحماية من هذا ، تتوفر بعض برامج الكمبيوتر التي تقلل من إخراج الشاشة والضوء الأزرق في المساء. تتوفر أيضًا النظارات الخاصة التي تحجب الضوء الأزرق. على الرغم من ارتباط الميلاتونين بالنوم في بعض الحيوانات (بما في ذلك البشر) ، يتم تنشيط الحيوانات الليلية عن طريق زيادة مستويات الميلاتونين. تغير أطوال النهار / الليل خلال العام يغير إنتاج الميلاتونين ويوفر إشارات بيولوجية للفصول. هذه مهمة بشكل خاص في التلوين الموسمي وعادات التكاثر لبعض الحيوانات. يوجد الميلاتونين في الكرز والموز والعنب والأرز والحبوب وزيت الزيتون والنبيذ والبيرة.

      السيروتونين ، أو 5-هيدروكسي تريبتامين ، هو ناقل عصبي أحادي الأمين مشتق من التربتوفان. تخزن الصفائح الدموية السيروتونين وتطلقه عندما ترتبط بجلطة ، مما يسبب تضيق الأوعية. يلعب السيروتونين دورًا في الوظائف الإدراكية ويعزز الذاكرة والتعلم. يُعتقد على نطاق واسع أن السيروتونين يساهم في الشعور بالسعادة والرفاهية. تعمل بعض الأدوية المضادة للاكتئاب الشائعة ، بما في ذلك Prozac و Paxil و Zoloft ، على تعديل عمل السيروتونين في نقاط الاشتباك العصبي.

      يُعرف النياسين أيضًا باسم فيتامين ب 3 وحمض النيكوتين. يمكن صنع النياسين من التربتوفان والأشخاص الذين لديهم عدم القدرة على امتصاص التربتوفان في الجهاز الهضمي تظهر عليهم أعراض مشابهة لنقص النياسين.

      يؤدي النقص الشديد في النياسين في النظام الغذائي إلى المرض المعروف باسم البلاجرا ، بينما ترتبط الكميات غير الكافية من النياسين في النظام الغذائي بالغثيان وفقر الدم والصداع والتعب. يمكن أن يؤدي النظام الغذائي الذي يتكون أساسًا من الحبوب مثل الذرة إلى نقص النياسين ، لأن النياسين في هذه المصادر غير متوفر بيولوجيًا بسهولة. إن معالجة الحبوب بالقلويات ، كما هو الحال في الممارسة المكسيكية التقليدية المتمثلة في نقع الذرة في الجير ، يمكن أن تجعل امتصاص النياسين أسهل من الطعام.

      يرتبط النياسين بالبيريدين وشكل الأميد منه هو نيكوتيناميد ، وهو مكون مهم في NAD + / NADH و NADP + / NADPH. تعتبر الأزواج الأخيرة من الجزيئات ضرورية كمستقبلات / حاملات للإلكترون لمعظم تفاعلات الأكسدة الخلوية والاختزال.

      الأكسينات هي هرمونات نمو نباتية مشتقة من التربتوفان. وأهمها حمض الإندول -3 أسيتيك (الشكل 6.151). تشارك Auxins في كل جانب من جوانب نمو النبات وتطوره تقريبًا. إنها تنشط البروتينات ، مثل الامتدادات والأنزيمات المختلفة التي تعدل بنية مكونات جدار الخلية ، لتفكيك جدران الخلايا في النبات وتحفيز استطالة الخلايا. في وجود السيتوكينين ، تحفز الأكسينات انقسام الخلايا. تشارك Auxins أيضًا في الحفاظ على الخلايا الإنشائية وفي تشكيل الخلايا وتكوين الأعضاء. الأكسينات ضرورية لإنشاء جذور الجذر وكذلك لإطالة شعر الجذر. تلعب الأكسينات أدوارًا مهمة في تنظيم نسيج الخشب واللحاء في النباتات ، ومن المعروف منذ فترة طويلة أن نسيج الكالس النباتي يمكن أن يتمايز إلى براعم أو جذور ، اعتمادًا على التركيزات النسبية للأوكسينات والسيتوكينينات المتوفرة في الوسط.

      تُدخِل الأجرعية الورمية ، وهي بكتيريا تصيب مجموعة واسعة من النباتات ، الحمض النووي الخاص بها ، بما في ذلك الجينات اللازمة لتخليق الهرمونات النباتية ، في الخلايا المضيفة وخلايا rsquos. يحفز الإنتاج المفرط اللاحق للأوكسينات نمو الأورام (تسمى كرات التاج) على النبات (الشكل 6.153).

      فينيل ألانين هو حمض أميني أساسي كاره للماء في البشر وهو مقدمة للتيروزين وبما أن التيروزين هو مقدمة للعديد من الكاتيكولامينات المهمة ، فإن فينيل ألانين هو ، بالتالي ، مقدمة لها أيضًا.

      يرتبط فينيل ألانين بالمرض الوراثي بيلة الفينيل كيتون (PKU) الذي ينشأ عن عدم القدرة على استقلاب الحمض الأميني لدى الأشخاص الذين يفتقرون (أو يعانون من نقص) إنزيم فينيل ألانين هيدروكسيلاز. إذا تُرك المرض دون علاج ، يمكن أن يسبب تلفًا في الدماغ وحتى الموت ، ولكن إذا تم اكتشافه مبكرًا ، يمكن إدارته بسهولة عن طريق مراقبة المدخول الغذائي للحمض الأميني بعناية. لهذا السبب ، يتم اختبار الأطفال حديثي الولادة بشكل روتيني للكشف عن بيلة الفينيل كيتون. فينيل ألانين هو أحد مكونات المُحلي الصناعي المعروف باسم الأسبارتام (Nutrasweet - الشكل 6.154) وبالتالي فهو خطير على الأشخاص الذين يعانون من هذا الاضطراب.

      يتداخل التخليق الحيوي للفينيل ألانين في البكتيريا مع تخليق التربتوفان. يحدث الفرع في حمض الكوريسميك حيث يحفز إنزيم المشيمية إعادة الترتيب الجزيئي لإنتاج مادة مسبقة الصبغية.

      ينتج عن هجوم البروتون على البروفينيت فقدان الماء وثاني أكسيد الكربون لإنتاج فينيل بيروفات.

      ينتج عن نقل فينيل بيروفات فينيل ألانين.

      بدلاً من ذلك ، يمكن للفينيل ألانين الحصول على مجموعته الأمينية في تفاعل انتقال من الألانين.

      ينتج عن الهيدروكسيل للفينيل ألانين بواسطة هيدروكسيلاز الأحماض الأمينية العطرية (فينيل ألانين هيدروكسيلاز) التيروزين.

      تيروزين

      نظرًا لأن التيروزين مصنوع من فينيل ألانين وهذا الأخير هو حمض أميني أساسي في البشر ، فليس من الواضح ما إذا كان يجب تصنيف التيروزين على أنه أساسي أم غير ضروري. يعرّفها البعض على أنها حمض أميني أساسي مشروط. يصنفه آخرون ببساطة على أنه غير ضروري.

      كما هو مذكور أعلاه ، يمكن أن ينشأ التيروزين نتيجة الهيدروكسيل للفينيل ألانين. بالإضافة إلى ذلك ، يمكن للنباتات تخليق التيروزين عن طريق أكسدة البروفينيت متبوعًا بنقل 4-هيدروكسي فينيل بيروفات الناتج (الشكل 6.155).

      تعتبر مجموعة الهيدروكسيل الموجودة في التيروزين هدفًا للفسفرة بواسطة إنزيمات بروتين كينيز المشاركة في مسارات نقل الإشارة (الشكل 6.156). عند وضعها في الأغشية ، يشار إلى هذه الإنزيمات باسم مستقبلات التيروزين كينازات وتلعب أدوارًا مهمة في التحكم في السلوك / الاستجابة الخلوية.

      في النظام الضوئي الثاني للبلاستيدات الخضراء ، يعمل التيروزين ، في قلب النظام ، كمتبرع للإلكترون لتقليل الكلوروفيل المؤكسد. يُفقد الهيدروجين من مجموعة الهيدروكسيل في التيروزين في هذه العملية ، مما يتطلب إعادة الاختزال بواسطة أربع مجموعات منغنيز أساسية.

      يعتبر التيروزين مهمًا أيضًا في الوحدة الفرعية الصغيرة من اختزال الريبونوكليوتيد من الفئة الأولى حيث يشكل جذريًا ثابتًا في العمل التحفيزي للإنزيم (انظر هنا).

      التيروزين هو طليعة الكاتيكولامينات ، مثل L-dopa ، والدوبامين ، والنورادرينالين ، والإبينفرين (الشكل 6.157). يتم تصنيع هرمونات الغدة الدرقية ثلاثي يودوثيرونين (T3) وهرمون الغدة الدرقية (T4) أيضًا من التيروزين. كما هو مبين في الشكل 6.158 ، يتضمن ذلك سلسلة من عمليات إضافة اليود للسلاسل الجانبية للتيروزينات لبروتين يعرف باسم ثيروجلوبولين. مجموعات من التيروزينات اليود تؤدي إلى هرمون الغدة الدرقية وثلاثي يودوثيرونين. يتم فصلها لاحقًا من البروتين وإطلاقها في مجرى الدم.

      تشترك أكسدة وبلمرة التيروزين في تخليق عائلة أصباغ الميلانين. يشارك Tyrosine في تخليق نوعين على الأقل - eumelanin و pheomelanin (الشكل 6.159).

      جزيء آخر مشتق من التيروزين هو جزء البنزوكوينون من الإنزيم المساعد Q (CoQ). يتطلب هذا المسار إنزيم HMG-CoA Reductase ، وبما أن هذا الإنزيم يتم تثبيته بواسطة أدوية الستاتين التي تخفض الكوليسترول ، يمكن أن يكون CoQ محدودًا في الأشخاص الذين يعالجون من ارتفاع مستويات الكوليسترول في الدم.

      الدوبامين

      يلعب الدوبامين عدة أدوار مهمة في الدماغ والجسم. عضو في عائلات الكاتيكولامين والفينيثيلامين ، يأتي اسمه من حقيقة أنه أمين مصنوع عن طريق إزالة مجموعة الكربوكسيل من L-DOPA. يتم تصنيع الدوبامين في الدماغ والكلى. كما أنه يصنع في النباتات ، على الرغم من أن وظيفته في النباتات غير واضحة. يتطلب تحويل الدوبامين إلى النوربينفرين (الشكل 6.157) فيتامين سي.

      الدوبامين هو ناقل عصبي ، يتم إطلاقه بواسطة خلية عصبية واحدة ثم ينتقل عبر المشبك للإشارة إلى خلية عصبية مجاورة. يلعب الدوبامين دورًا رئيسيًا في الدماغ والسلوك بوساطة المكافأة rsquos. المكافآت ، مثل الطعام أو التفاعل الاجتماعي ، تزيد من مستويات الدوبامين في الدماغ ، كما تفعل العقاقير المسببة للإدمان. وتشارك مسارات الدوبامين الأخرى في الدماغ في التحكم في الحركة وإدارة إفراز الهرمونات المختلفة.

      خارج الجهاز العصبي ، الدوبامين هو مرسال كيميائي محلي. في الأوعية الدموية ، يمنع إفراز النوربينفرين ويسبب توسع الأوعية. في الكلى ، يزيد من إفراز الصوديوم وإخراج البول. يقلل من حركية الجهاز الهضمي ويحمي الغشاء المخاطي المعوي في الجهاز الهضمي وفي جهاز المناعة ، ويقلل من نشاط الخلايا الليمفاوية. تأثير الدوبامين على البنكرياس هو تقليل إنتاج الأنسولين. باستثناء الأوعية الدموية ، يتم تصنيع الدوبامين محليًا ويمارس تأثيره بالقرب من الخلايا التي تطلقه.

      الإبينفرين (ويسمى أيضًا الأدرينالين) هو كاتيكولامين مرتبط كيميائيًا بالنورادرينالين وهو هرمون له تطبيقات طبية. يتم استخدامه لعلاج الحساسية المفرطة ، والسكتة القلبية ، والخناق ، وفي بعض الحالات ، الربو ، عندما لا تعمل العلاجات الأخرى ، بسبب قدرته على تفضيل توسع القصبات.

      الإبينفرين هو الدواء المفضل لعلاج الحساسية المفرطة. يمكن إعطاء المركب عن طريق الاستنشاق أو الحقن في الوريد أو الحقن تحت الجلد ويمارس تأثيرات من خلال مستقبلات ألفا وبيتا الأدرينالية. في الجسم ، يتم إنتاجه وإطلاقه بواسطة الغدد الكظرية وبعض الخلايا العصبية.

      قد تشمل التأثيرات الفسيولوجية للإبينفرين سرعة ضربات القلب ، وزيادة ضغط الدم ، وناتج القلب ، واتساع حدقة العين ، وتركيز السكر في الدم ، وزيادة التعرق. قد تشمل الآثار الجسدية الأخرى الاهتزاز وزيادة القلق واضطراب نظم القلب.

      Norepinephrine (ويسمى أيضًا noradrenalin) هو جزيء الكاتيكولامين الذي يعمل كهرمون وناقل عصبي. إنه مشابه كيميائيًا للإبينفرين ، ويختلف فقط في حالة عدم وجود مجموعة ميثيل على أمينه. يتم إنتاج النوربينفرين وإفرازه بواسطة الجهاز العصبي المركزي (الموضع الأزرق للدماغ) والجهاز العصبي الودي. يتم إطلاق المركب في مجرى الدم من الغدد الكظرية ويؤثر على مستقبلات ألفا وبيتا الأدرينالية.

      يكون النوربينفرين في أدنى مستوياته أثناء النوم وعند أعلى مستوياته أثناء الإجهاد (استجابة القتال أو الطيران). تتمثل الوظيفة الأساسية للنوربينفرين في تحضير الجسم للعمل. يزيد من اليقظة ، ويعزز وظائف الذاكرة ، ويساعد على تركيز الانتباه. يزيد النوربينفرين من معدل ضربات القلب وضغط الدم ، ويزيد من نسبة الجلوكوز في الدم وتدفق الدم إلى العضلات الهيكلية ويقلل من تدفق الدم إلى الجهاز الهضمي.

      يمكن حقن النوربينفرين للتغلب على انخفاض ضغط الدم الحاد وتستخدم الأدوية المضادة لتأثيراته في علاج أمراض القلب. وحاصرات ألفا ، على سبيل المثال ، تستخدم لمحاربة اضطرابات القلب والأوعية الدموية والنفسية. وحاصرات بيتا تعارض مجموعة مختلفة من تأثيرات النوربينفرين ورسكووس عن وحاصرات ألفا وتستخدم لعلاج الجلوكوما والصداع النصفي ومشاكل القلب والأوعية الدموية الأخرى.

      تتكون عائلة الأحماض الأمينية المشتقة من البيروفات من أربعة أعضاء ، ولكل منها سلسلة جانبية أليفاتية بسيطة لا تزيد عن أربعة كربون. أبسطها هو ألانين.

      ألانين هو الحمض الأميني الذي يتم إنتاجه بسهولة من البيروفات. ينتج النقل البسيط المحفز بواسطة alanine transaminase ألانين من البيروفات.

      تشمل المسارات البديلة لتوليف الألانين تقويض الفالين ، والليوسين ، والإيزولوسين.

      دورة الجلوكوز ألانين هي دورة نيتروجين مهمة تتعلق بدورة كوري التي تحدث بين خلايا العضلات والكبد في الجسم (انظر هنا). في ذلك ، يؤدي انهيار الجلوكوز في العضلات إلى البيروفات. عندما تكون مستويات النيتروجين عالية ، يتم نقل البيروفات إلى ألانين ، والذي يتم تصديره إلى خلايا الكبد.

      في خلايا الكبد ، يحدث النقل الأخير لدورة الجلوكوز ألانين. يتم نقل مجموعة الأمين من الألانين إلى & alpha-ketoglutarate لإنتاج البيروفات والغلوتامات. يمكن بعد ذلك صنع الجلوكوز عن طريق استحداث السكر من البيروفات. الأهم من ذلك ، أن تحلل الغلوتامات ينتج أيون الأمونيوم ، والذي يمكن تحويله إلى يوريا لإفرازه ، وبالتالي تقليل حمل الجسم و rsquos للأمينات السامة المحتملة. قد يكون هذا المسار مهمًا بشكل خاص في الدماغ.

      طريقة أخرى لإزالة الأمونيوم الزائد من الأنسجة هي عن طريق ربطه بالجلوتامات لصنع الجلوتامين. الجلوتامات هو ناقل عصبي ، لذا فإن وجود طريقة بديلة لإزالة الأمينات (دورة الجلوكوز ألانين) أمر مهم ، خاصة في الدماغ.

      مثل الفالين والإيزولوسين ، يعتبر الليوسين من الأحماض الأمينية الأساسية في البشر. في الأنسجة الدهنية والعضلات ، يستخدم الليوسين في تخليق الستيرول. إنه الحمض الأميني الوحيد الذي يحفز تخليق البروتين العضلي ، وكمكمل غذائي في الجرذان المسنة ، فإنه يبطئ من تدهور العضلات. Leucine هو منشط لـ mTOR ، وهو بروتين ، عندما يتم تثبيته ، فقد ثبت أنه يزيد من العمر الافتراضي في Saccharomyces cerevisiae و C. elegans و Drosophila melanogaster.

      يبدأ استقلاب الليوسين والفالين والأيزولوسين (يُطلق عليه أيضًا الأحماض الأمينية ذات السلسلة المتفرعة - BCAAs) بنزع الكربوكسيل من البيروفات وربط جزء هيدروكسي إيثيل ثنائي الكربون ببيروفوسفات الثيامين (الشكل 6.161). يستمر استقلاب الأيزولوسين مع ربط قطعة هيدروكسيل ثنائية الكربون (هيدروكسي إيثيل- TPP) بـ & alpha-ketobutyrate ويتم تغطيتها في القسم الذي يصف هذا الحمض الأميني (انظر هنا).

      يستمر استقلاب الفالين والليوسين مع ربط قطعة هيدروكسي إيثيل من TPP إلى بيروفات أخرى لتكوين ألفا أسيتولاكتات. إعادة ترتيب & alpha-acetolactate بواسطة acetolactate mutase يجعل 3-hydroxy-3-methyl-2-oxobutanoate.

      التخفيض باستخدام NAD (P) H بواسطة غلات حمض الأسيتوهيدروكسي أيزوميروروكتاز وألفا وبيتا ديهيدروكسي أيزوفاليرات.

      فقدان الماء المحفز بواسطة ثنائي هيدروكسي أسيد ديهيدراتاز ينتج ألفا كيتوإيزوفاليرات.

      هذا الجزيء هو نقطة فرعية لتخليق الليوسين والفالين. إضافة مجموعة أسيتيل من محصول أسيتيل CoA وألفا إيزوبروبيل مالات (محفز بواسطة سينثيز ألفا إيزوبروبيل مالات).

      إعادة الترتيب ، التي يتم تحفيزها بواسطة نازعة الأيزوبروبيلمالات ، تؤدي إلى ظهور بيتا آيزوبروبيل مالات.

      الأكسدة عن طريق نازعة هيدروجين الأيزوبروبيلمالت و NAD + ، تعطي & ألفا كيتوايسوكابروات.

      نقله (المحفز بواسطة ليسين أمينوترانسفيراز واستخدام الغلوتامات) يعطي المنتج النهائي من الليوسين (أعلى العمود التالي).

      حمض أميني أساسي في البشر ، فالين مشتق من نباتات البيروفات ويشترك في جزء من مسار التوليف الأيضي مع الليوسين وشريحة صغيرة منه مع الأيزولوسين. يبدأ استقلاب جميع الأحماض الأمينية الثلاثة بنزع الكربوكسيل من البيروفات وربط جزء هيدروكسي إيثيل ثنائي الكربون ببيروفوسفات الثيامين (الشكل 6.161) ، كما هو مذكور أعلاه.

      كما رأينا سابقًا ، فإن alpha-ketoisovalerate هو الجزيء عند النقطة في المسار الأيضي حيث يتم تخليق فروع الفالين من تلك الموجودة في leucine. في الواقع ، فإن alpha-ketoisovalerate تبعد خطوة واحدة فقط عن الفالين. إن نقل و alpha-ketoisovalerate المحفز بواسطة فالين isoleucine aminotransferase يعطي فالين.

      يبدأ تخليق isoeleucine (حمض أميني أساسي في البشر) في النباتات والكائنات الحية الدقيقة مع البيروفات و & alpha-ketobutyrate (منتج ثانوي لاستقلاب الثريونين - ثريونين ديميناز - الشكل 6.162).

      يستمر استقلاب الأيزولوسين مع التعلق بـ & alpha-ketobutyrate لمنتج hydroxyethyl-TPP لنزع الكربوكسيل من البيروفات لتشكيل و alpha-aceto- & alpha-hydroxybutyrate. يتم تحفيز التفاعل بواسطة سينسيز أسيتولاكتات. إعادة الترتيب والاختزال بواسطة أيزوميروروكتاز حامض أسيتو هيدروكسي وعوائد NAD (P) H و alpha و beta-dihydroxy- و beta-methylvalerate. يظهر في الصفحة التالية.

      فقدان الماء (المحفز بواسطة ديهيدروكسي أسيد ديهيدراتاز) يعطي & alpha-keto- & beta-methylvalerate.

      & Tauransamination (باستخدام الغلوتامات والفالين isoleucine transaminase) ينتج isoleucine.

      ومن المثير للاهتمام أن العديد من إنزيمات استقلاب الفالين تحفز التفاعلات في مسار الأيزولوسين. على الرغم من اختلاف الركائز قليلاً ، إلا أنها كافية مثل مركبات الفالين الوسيطة التي يتم التعرف عليها على أنها ركائز.

      يحتوي Isoleucine على مركز غير متماثل ثانٍ بداخله ، ولكن تم العثور على شكل بيولوجي واحد فقط من الأشكال الأربعة المحتملة من المركزين.

      يعد تنظيم تخليق الأحماض الأمينية المتفرعة السلسلة (BCAAs - فالين ، وليوسين ، وإيزولوسين) أمرًا معقدًا. الجزيء الرئيسي في اللائحة هو & alpha-ketobutyrate ، والذي يتم تصنيعه في الخلايا كمنتج تحلل لثريونين. الإنزيم الذي يحفز تركيبه هو threonine deaminase (الشكل 6.162) ، والذي يتم تنظيمه بشكل خيفي. يُثبط الإنزيم بمنتجه الخاص (إيزولوسين) ويتم تنشيطه بواسطة فالين ، وهو نتاج مسار موازٍ.

      وهكذا ، عندما يكون تركيز الفالين مرتفعًا ، تتحول التوازنات لصالح إنتاج الإيزولوسين وبما أن الأيزولوسين يتنافس مع الفالين والليوسين من أجل هيدروكسي إيثيل- TPP ، فإن تخليق هذين الأحماض الأمينية ينخفض. عندما يزيد تركيز إيزولوسين ، يتم تثبيط ثريونين ديميناز ، مما يؤدي إلى تحويل التوازن إلى إنتاج الفالين والليوسين.

      توهين

      تحدث آلية تحكم أخرى لتنظيم تخليق الليوسين في البكتيريا وتُعرف باسم التوهين. في هذه الطريقة ، يؤدي تراكم الليوسين إلى تسريع عملية ترجمة جزء من نسخة الرنا المرسال من أوبرون لوسين (تسلسل ترميز الإنزيمات اللازمة لصنع الليوسين). وهذا بدوره يؤدي إلى إنهاء نسخ جينات أوبرون الليوسين قبل الأوان ، وبالتالي وقف إنتاج الإنزيمات اللازمة لصنع الليوسين.

      عندما تنخفض مستويات الليوسين ، تتباطأ الترجمة ، مما يمنع النسخ من الإنهاء المبكر ويسمح بإنزيمات استقلاب الليوسين. وبالتالي ، فإن مستويات الليوسين في الخلية تتحكم في تخليق الإنزيمات اللازمة لصنعه.


      1. تيان ب
      2. ستيوارد أ
      3. كودفا ر
      4. سو تي
      5. شلن PJ
      6. نيكسون أ
      7. هولينز جي
      8. بيكمان ر
      9. فون هاين جي
      10. كلارك ج
      11. أفضل RB

      حرصًا على الشفافية ، تنشر eLife طلبات المراجعة الأكثر جوهرية وإجابات المؤلفين المصاحبة لها.

      هذا تقرير أنيق عن عملية إدخال البروتين الغشائي في كل مكان ، تمت دراسته في الجسم الحي وفي المختبر باستخدام النموذج البكتيري بكتريا قولونية - استغلال ثلاثة بروتينات غشائية نموذجية ذات تعقيد طوبولوجي متزايد. أثبت استغلال تحليل ملف تعريف القوة (FPA) الذي تم تطويره في مختبر von Heijne - بدقة عالية الآن - أنه قوي جدًا ومكمل لتقنيات أخرى مثل محاكاة MD (تم نشرها هنا أيضًا). وكانت النتيجة معرفة جديدة بالتفاصيل الجزيئية لإدخال بروتين الغشاء. الأهم من ذلك ، تكشف الورقة عن عدد من الجوانب المثيرة للاهتمام للغاية لهذه العملية.

      خطاب القرار بعد مراجعة الأقران:

      شكرًا لك على إرسال مقالتك "تحليل المخلفات عن طريق البقايا لتكامل بروتين الغشاء المتحد في الجسم الحي" للنظر فيه من قِبل eLife. تمت مراجعة مقالتك من قبل ثلاثة من المراجعين النظراء ، وأشرف على التقييم المحرر المراجع وأولغا بودكر بصفتها المحرر الأول. وافق الشخص التالي الذي شارك في مراجعة إرسالك على الكشف عن هويته: إيان كولينسون (المراجع رقم 2).

      ناقش المراجعون المراجعات مع بعضهم البعض وصاغ المحرر المراجع هذا القرار لمساعدتك في إعداد إرسال منقح.

      نود أن نلفت انتباهك إلى التغييرات في سياسة المراجعة التي أجريناها استجابةً لـ COVID-19 (https://elifesciences.org/articles/57162). على وجه التحديد ، نطلب من المحررين أن يقبلوا دون تأخير المخطوطات ، مثل مخطوطاتك ، التي يرون أنها يمكن أن تكون كذلك eLife أوراق بدون بيانات إضافية ، حتى لو شعروا أنهم سيجعلون المخطوطة أقوى. وبالتالي فإن التنقيحات المطلوبة أدناه تتناول فقط الوضوح والعرض.

      هذا تقرير أنيق عن عملية إدخال البروتين الغشائي في كل مكان ، تمت دراسته في الجسم الحي وفي المختبر باستخدام النموذج البكتيري بكتريا قولونية - استغلال ثلاثة بروتينات غشائية نموذجية ذات تعقيد طوبولوجي متزايد.

      إن معرفتنا بآلية إدخال البروتين الغشائي سطحية إلى حد ما ويقود المؤلفون الطريق في هذا المجال. هذه المخطوطة هي مثال رئيسي - وبالتالي فهي جديرة بالنشر في شكل قريب من شكلها الحالي (بالتأكيد ليست هناك حاجة لمزيد من التجارب).

      أثبت استغلال تحليل ملف تعريف القوة (FPA) الذي تم تطويره في مختبر von Heijne - بدقة عالية الآن - أنه قوي جدًا ومكمل لتقنيات أخرى مثل محاكاة MD (تم نشرها هنا أيضًا). وكانت النتيجة معرفة جديدة بالتفاصيل الجزيئية لإدخال بروتين الغشاء. الأهم من ذلك ، تكشف الورقة عن عدد من الجوانب المثيرة للاهتمام للغاية لهذه العملية:

      هذا تقرير أنيق عن عملية إدخال البروتين الغشائي في كل مكان ، تمت دراسته في الجسم الحي وفي المختبر باستخدام النموذج البكتيري بكتريا قولونية - استغلال ثلاثة بروتينات غشائية نموذجية ذات تعقيد طوبولوجي متزايد.

      إن معرفتنا بآلية إدخال البروتين الغشائي سطحية إلى حد ما ويقود المؤلفون الطريق في هذا المجال. هذه المخطوطة هي مثال رئيسي - وبالتالي فهي جديرة بالنشر في شكل قريب من شكلها الحالي (بالتأكيد ليست هناك حاجة لمزيد من التجارب).

      أثبت استغلال تحليل ملف تعريف القوة (FPA) الذي تم تطويره في مختبر von Heijne - بدقة عالية الآن - أنه قوي جدًا ومكمل لتقنيات أخرى مثل محاكاة MD (تم نشرها هنا أيضًا). وكانت النتيجة معرفة جديدة بالتفاصيل الجزيئية لإدخال بروتين الغشاء. الأهم من ذلك ، تكشف الورقة عن عدد من الجوانب المثيرة للاهتمام للغاية لهذه العملية:

      تم اقتباس ما يلي من جلسة التشاور التي تحدد النقاط الرئيسية التي يشعر المراجعون بضرورة معالجتها في تقديمك المنقح. لقد قمت بتضمين التعليقات الكاملة للمراجعين للنظر فيها. ومع ذلك ، لا يلزم تناول هذه الأمور بالتفصيل في إجابتك المصاحبة لتقديم مخطوطتك المنقحة.

      هناك عدد من القضايا الفنية التي تحتاج إلى معالجة في نص منقح بما في ذلك الاستنتاجات التي تحتاج إلى تعديل. إذا كان الطي الترجمي المشترك لشرائح عديد الببتيد في نفق الريبوسوم يمكن أن يؤثر على عملية التكامل (التي يزعم المؤلفون حدوثها) ، ففي بعض الحالات يكون من الصعب استخدام اندماج Lep لحل المشكلات التقنية المتعلقة بالكشف. في تلك الحالات ، لم يعد البولي ببتيد الأصلي هو سياق مشكلة الاكتشاف هذه.

      ربما يمكن للمؤلفين إظهار أن ملامح القوة لا تتأثر بوجود بروتينات الاندماج؟ بالطبع ، إذا تأثرت النتائج ، فيجب تغيير الاستنتاجات وفقًا لذلك.

      ومع ذلك ، قد يكون من الصعب إظهار ذلك بشكل مقنع نظرًا لاستخدام Lep مع Btu للسماح بتفسير نمط شريط البروتين. المعنى الضمني هو أن Lep تؤثر على عملية التكامل أو الطي. علاوة على ذلك ، يدعي المؤلفون أن التسلسلات الأولية من الطرف N قد تؤثر على التكامل عن طريق الطي الترجمي المشترك كما في حالة منطقة NTD في GlpG. وبالتالي فإن استبدال Lep لمثل هذه التسلسلات قد يتداخل مع عملية الطي / التكامل.

      بالنظر إلى الاتفاق الجيد السابق لمجموعة von Heijne مع محاكاة MD ، ربما يمكن استخدام هذا النهج للوصول إلى الاختلاف من السلوك الأصلي.

      ربما يكون التحليل الحالي مقبولاً للتركيبات الطويلة بما فيه الكفاية (بالنسبة لـ GlpP ، N & gt120 ، يتم كشف جزء LepB بطول 58 بقايا بالكامل خارج الريبوسوم ولا يتعامل مع SecY). ربما يكون GlpP جيدًا في هذا الصدد لأن التركيبات المصهورة LepB هي N = 131-224. بالطبع ، يحتوي LepB على مرساة غشائية ، ولا نعرف كيف أثر ذلك على FP لـ GlpP. قد يكون لديهم بعض بيانات GlpG الأصلية إلى جانب تلك التي تحتوي على نطاقات متعددة ، مما قد يكون مفيدًا. بالنسبة إلى BtuC ، فإنها تُظهر بعض البيانات على الأقل بدون اندماج LepB (الشكل 4 - ملحق الشكل 1B). هذا جيد لأن هذه التركيبات أقصر ، والتي كان من الممكن أن تكون أكثر تأثراً بـ LepB. ومع ذلك ، فإن المحاذير المحتملة في تفسيراتهم تحمل التصحيح.

      قد يكون من المفيد تضمين الصور الأولية وبعض التوضيحات المتعلقة بإحصاءات التجارب حيث لم يكن هناك سوى مكررين بيولوجيين ..

      يمكن معالجة القضايا الرئيسية الملخصة أعلاه من قبل المؤلفين دون تجارب إضافية. يقدم المراجع رقم 1 اختبارات تجريبية إضافية ، لكنها لا تعتبر ضرورية لمراجعة مرضية لهذا العمل الأكثر إثارة للاهتمام.

      المخطوطة التي كتبها نيكولاس وآخرون. اتبعت التكامل الترجمي المشترك لثلاثة بروتينات غشائية متعددة الامتدادات باستخدام تحليل ملف تعريف القوة (FP) ، وهي الطريقة التي كانت رائدة سابقًا من قبل مجموعة von Heijne. يستخدم هذا النهج اندماجًا طرفيًا C لببتيد إيقاف الترجمة إلى بروتينات قابلة للذوبان أو بروتينات غشائية ذات اقتطاعات متفاوتة. ينتج عن الطي أو التكامل الغشائي للسلسلة الناشئة قوة سحب ، والتي يمكن قراءتها من مدى كفاءة ببتيد الإيقاف في التسبب في توقف الترجمة. في السابق ، قامت المجموعة بتحليل إدخال الغشاء لنموذج حلزونات غشاء مفردة (TMHs) بالتفصيل (إسماعيل وآخرون ، 2012). الآن قاموا بتوسيع النهج ليشمل البروتينات الغشائية متعددة الامتدادات (وأكثر محلية) ، وهي EmrE و GlpG و BtuC. استنتج المؤلفون أن بياناتهم تدعم ما يسمى بالنموذج "المنزلق" لتكامل TMH ، حيث تنزلق كل TMH على طول البوابة الجانبية المفتوحة لقناة SecYEG. كما يقدمون أيضًا العديد من الملاحظات المثيرة للاهتمام ، مثل تأثيرات المخلفات المشحونة ، وحلقات إعادة الدخول ، وحلزونات السطح على توقيت تكامل TMS ، على الرغم من أن هذه تتطلب المزيد من البيانات لتعميمها.

      تتمثل إحدى نقاط الضعف الرئيسية في الدراسة في اعتمادها الحصري على تحليل FP. تم أيضًا استخدام عمليات محاكاة MD ذات الحبيبات الخشنة ولكن بدلاً من ذلك لتأكيد الملاحظات من تحليل FP. يتمثل أحد قيود تحليل FP في أنه يراقب فقط (بشكل غير مباشر) إدخال آخر TMH بالقرب من قناة SecYEG. لا يتناول التحليل ما سيحدث لـ TMHs السابقة (مثل طي TMD ، أو الإدراج المتأخر ، أو التقليب المحتمل لـ TMD) مع نمو عديد الببتيد. تتمثل نقطة الضعف الثانية في أن الدراسة تضيف فقط تحديثات ثانوية (تأثيرات المخلفات المشحونة وحلقات إعادة الدخول وحلزونات السطح) إلى النموذج السابق.

      على الرغم من نقاط الضعف ، فإن هذا العمل يوفر رؤى وموارد مفيدة للميدان ، وبالتالي أعتبره مناسبًا للنشر في eLife مع المراجعة. لا يزال التكامل الغشائي لبروتينات الغشاء متعدد الامتدادات عملية غير مفهومة جيدًا ، ويرجع ذلك إلى حد كبير إلى وجود عدد قليل جدًا من الأدوات التجريبية المتاحة للباحثين لمتابعة العملية. إن تحليل المؤلفين بشكل عام عالي الجودة ، وتفسيراتهم معقولة.

      1) ربما يصعب على العلماء خارج المجال متابعة النسخة الحالية من المخطوطة. سيكون من الأفضل توسيع المقدمة لتزويد غير الخبراء بمزيد من المعلومات الأساسية حول المسار ، مثل النموذج العام لنقل البروتين بوساطة SecYEG وتكامل الغشاء ، وما هو معروف عن تكامل بروتين الغشاء ، وما هي الأسئلة الرئيسية التي يجب طرحها. عنوان.

      2) كما في النقطة رقم 1 ، فإن الشكل الكرتوني الذي يظهر النموذج "المنزلق" الموضح في المناقشة سيكون مفيدًا في تحسين إمكانية القراءة.

      3) بخصوص النقطة رقم 2. على الرغم من أن المؤلفين لم يذكروا هذا صراحةً ، فإن النموذج المعارض للنموذج المنزلق سيكون نموذج "الداخل إلى الخارج" ، حيث ينزل TMS أولاً على طول مسام النقل ثم يقسم إلى الطور الدهني من خلال البوابة الجانبية المفتوحة. ومع ذلك ، في رأيي ، الاختلافات الميكانيكية بين النموذجين صغيرة نوعًا ما ، والحدود بين البوابة الجانبية والمسام ليست واضحة المعالم (أيضًا ، يمكن للدهون أن تدخل جزئيًا ذيول أسيل في البوابة الجانبية المفتوحة وتتصل بسلسلة البولي ببتيد في المسام). يجب على المؤلفين أن يصفوا بوضوح سبب احتواء البيانات في النموذج "المنزلق" وليس النموذج "الداخل إلى الخارج". كما أن "الانزلاق على طول البوابة الجانبية المفتوحة" غير واضح. من الممكن أن يبقى TMH خارج البوابة الجانبية مباشرةً أثناء انزلاقه عبر الغشاء (على غرار الهياكل التي شوهدت في دراسات وسائط النقل التي تحتوي على TMHs أو تسلسل الإشارات).

      4) في الدراسة السابقة التي أجراها إسماعيل وآخرون ، لوحظ وجود قوة سحب ثنائية الطور. في الدراسة الحالية ، لا يبدو أن FPs تظهر بوضوح مثل هذا النمط ثنائي الطور. هل يمكن للكتاب مناقشة هذا؟

      5) بالنسبة لبعض الملاحظات ، يقول المؤلفون ببساطة أنه ستكون هناك حاجة إلى مزيد من الدراسات لفهم (على سبيل المثال ، التفاعلات طويلة المدى البقايا والمخلفات). بدلاً من ذلك ، يجب على المؤلفين على الأقل تقديم تفسير محتمل أو اقتراح فرضية قابلة للاختبار.

      6) "وبالمثل ، من المحتمل أن يعكس الذروة VI-a تكامل الغشاء لجزء السيتوبلازمي المرتبط بالغشاء الكارهة للماء والذي يقع في الجزء العلوي من TMH5 ، الشكل 3 - ملحق الشكل 1B. في المقابل ، فإن ارتفاع N بشكل غير متوقعبداية تشير قيمة الذروة IV إلى أن تكامل TMH3 يبدأ فقط عندما تكون نهايته N-terminal

      52 من البقايا بعيدًا عن PTC ربما بسبب التباعد الضيق بين TMH2 و TMH3. ". يمكن اختبارها عن طريق الطفرات وإدخال امتداد محب للماء بين TMH2 و TMH3. كيف يمكن للتباعد الضيق بين TMH2 و TMH3 أن يتسبب في تأخر إدخال TMH3؟

      7) أساس نبداية ونالأعلى بالنسبة لمؤامرة أرجواني (متحولة) في الشكل ثلاثي الأبعاد ، ليس واضحًا لأنه يبدو أن هناك ثلاث قمم محلية. ماذا تمثل هذه القمم والصغرى المحلية؟

      8) بشكل عام ، يستخدم المؤلفون فقط Nبداية مواقف للتفسيرات. ولكن من المثير للاهتمام ، أن عروض الذروة متغيرة تمامًا بين TMHs. هل هناك أي ارتباط بين عروض الذروة وتسلسلات TMH (أو خصائصها الهيكلية)؟

      9) نتائج الفقرة الأخيرة: إنه لأمر محير لماذا لا توجد قوة سحب لـ TMH6 ولكن هناك قمتان قويتان قبل وبعد. هل يستطيع المؤلفون تقديم تفسير لهذه الملاحظة يتجاوز البيان العام؟ هل الطفرات في اللولب المحيط بالعودة للدخول تؤثر على القمم؟

      هذا تقرير أنيق عن عملية إدخال البروتين الغشائي في كل مكان ، تمت دراسته في الجسم الحي وفي المختبر باستخدام النموذج البكتيري بكتريا قولونية - استغلال ثلاثة بروتينات غشائية نموذجية ذات تعقيد طوبولوجي متزايد.

      إن معرفتنا بآلية إدخال البروتين الغشائي سطحية إلى حد ما ويقود المؤلفون الطريق في هذا المجال. هذه المخطوطة هي مثال رئيسي - وبالتالي فهي جديرة بالنشر في شكل قريب من شكلها الحالي (بالتأكيد ليست هناك حاجة لمزيد من التجارب).

      أثبت استغلال تحليل ملف تعريف القوة (FPA) الذي تم تطويره في مختبر von Heijne - بدقة عالية الآن - أنه قوي جدًا ومكمل لتقنيات أخرى مثل محاكاة MD (تم نشرها هنا أيضًا). وكانت النتيجة معرفة جديدة بالتفاصيل الجزيئية لإدخال بروتين الغشاء. الأهم من ذلك ، تكشف الورقة عن عدد من الجوانب المثيرة للاهتمام للغاية لهذه العملية:

      - قدرة نطاقات العصارة الخلوية القابلة للذوبان على الانثناء بينما لا تزال في نفق خروج الريبوسوم

      - يمكن أن يكون لبدائل aa الخاصة بالموقع تأثيرات طويلة المدى على FPA ، مما يدل على طي TMH التعاوني وإدخاله.

      - تفقد حلزونات الأغشية العابرة للأغشية (TMH) بسرعة "قوة سحبها" ، وتفسر على أنها دخول غشاء مبكر.

      تدعم النتائج دليل البناء لصالح "نموذج منزلق" لإدخال البروتين الغشائي ، حيث تكون TMHs المدمجة دائمًا على اتصال مع الدهون في الواجهة بين مجمع Sec والطبقة الثنائية.

      ليس لدي مخاوف جوهرية بشأن العمل. تهانينا للمؤلفين على دراستهم ، أفهم أنه يجب أن يكون قدرا كبيرا من العمل.

      من الناحية الفنية ، هذه دراسة متقدمة جدًا. ومع ذلك ، هناك مشكلات فنية في البيانات إما تم تجاهلها أو تهميشها من قبل المؤلفين ، ولكن يمكن أن تؤثر على استنتاجات العمل على بروتينات الغشاء الفردية. يتعلق هذا بشكل خاص باستخدام متواليات Lep في اندماج البروتين للحصول على المزيد من البيانات "القابلة للتفسير".

      يعرض الشكل 1 أمثلة لبروتينات الغشاء الثلاثة التي تم اختبارها في كيفية تطبيق FPA. هذه كلها قياسات SDS-PAGE / مطاردة النبض مع اقتطاع بروتين غشائي تم القبض عليه بواسطة ببتيد توقف انتقالي. اعتمادًا على البنية ، يتم استخدام ببتيدات توقيف مختلفة لضبط نافذة القوة. تم إجراء هذا النوع من التجارب لمجموعة كبيرة جدًا من اقتطاعات البروتين ، وقد تم تلخيص هذه البيانات في الأشكال 2-4 في الرسوم البيانية للموضع مقابل القوة. يجب على المؤلفين جعل البيانات الخام (صور SDS-PAGE كما في الشكل 1C) يمكن الوصول إليها كمورد خارجي بحيث يمكن فحص البيانات الفعلية.

      توافر البيانات: مع العرض التقديمي الحالي ، لا توجد طريقة للوصول إلى جودة البيانات. من الواضح بالفعل أن هناك أوجه غموض من الشكل 1C مع EmrE. يبدو أن الببتيد الموقوف يظهر على شكل شريطين مما يشير إلى مشكلة لا يتم مناقشتها بمزيد من التفصيل. ليس من الواضح ما إذا كان النطاق السفلي مشمولًا في تحديد شدة A ، كما أنه ليس من الواضح ما هي طبيعة شريط البروتين هذا. نظرًا لعدم توفر البيانات الخام ، يصعب الوصول إلى ما إذا كان هناك المزيد من المشكلات المتعلقة بالبيانات وكيف سيؤثر ذلك على نتيجة العمل.

      على ما يبدو ، مع GlpG ، أدت التركيبات ذات N 140-160 إلى ظهور نطاقات متعددة على SDS-PAGE كان من الصعب تفسيرها. تم حل هذه المشكلة عن طريق دمج جزء من بروتين Lep في الطرف N من GlpG. يقع الجزء Lep في نفق الريبوسوم مع تراكيب البروتين التي تم توقيفها من AP. يبدو هذا غير مرضٍ ، مثل تسلسل Lep الذي لا علاقة له تمامًا بعملية تكامل GlpG. نظرًا لأن تسلسل Lep هذا يؤثر على ما يبدو على نمط شريط البروتين ، فمن الواضح أنه ليس ثابتًا للعملية الكلية. وبالتالي من الصعب القول أنه باستخدام امتدادات Lep ، يتم الحصول على بيانات ذات مغزى.

      فيما يتعلق بالتعليق أعلاه ، أيضًا مع BtuC ، يتم استخدام دمج Lep. إذا كان الطي الترجمي المشترك في نفق الريبوسوم يمكن أن يؤثر على القوى المقاسة كما يدعي المؤلفون ، فإن استبدال أجزاء من GlpP و BtuC بـ Lep سيؤثر بالتأكيد على نتيجة العمل.

      يجادل المؤلفون بأن الطي الترجمي المشترك لـ NTD لـ GlpG في نفق الريبوسوم يحدث.مع طي المؤلفين ربما يعني تشكيل هيكل ثانوي؟ في الإعداد التجريبي ، يتم استخدام السلاسل الموقوفة ، ويلزم إجراء معالجة كيميائية حيوية طويلة قبل القراءة. كيف يمكن للمؤلفين التأكد من أن هذا الطي مناسب أيضًا لعملية ترجمة / تكامل حقيقية دون عائق؟ هنا ، يجب التعامل مع الأهمية الفسيولوجية للملاحظة بحذر.


      نقاش

      من خلال تحليل الطفرة النقطية واستخدام الجسم المضاد الخاص بالفوسفو ، أظهرنا أن ارتباط DYRK1A بـ 14-3-3β يتطلب فسفرة Ser-520 ، وهي بقايا موجودة في الطرف C من البروتين ومؤطرة في 14-3-3-وضع الإجماع أنا عزر. تم الإبلاغ عن ارتباط DYRK1A و 14-3-3 سابقًا (Kim وآخرون.، 2004) ، لكن المؤلفين لم يحددوا أي متطلبات للفسفرة للتفاعل. قد يكون أحد التفسيرات لهذه النتيجة المتضاربة على ما يبدو هو المقاومة التفاضلية للمعالجة بالفوسفاتيز لمركب Ser-520 الفسفوري وبقايا صور الفسفرة التي استخدمها كيم. وآخرون. (2004) كعنصر تحكم في علاجهم بالفوسفاتيز (الشكل التكميلي S3 ، C). يمكن أن يكمن تفسير آخر محتمل في وجود ظروف تجريبية مختلفة أو خصوصية نمط نظري 14-3-3. ومع ذلك ، فإن جميع الأدلة التجريبية المقدمة في هذه الدراسة تشير بقوة إلى أن التفاعل بين DYRK1A و14-3-3β يعتمد على الفسفرة ، كما هو الحال بالنسبة لمعظم 14-3-3 شركاء (Aitken ، 2006).

      بالإضافة إلى موقع ربط phospho-Ser-520 ، يوجد مجال تفاعلي آخر 14-3-3 في DYRK1A ، ضمن أول 150 حمض أميني من طرف N. يبدو أن كلا الموقعين ضروريان للربط 14-3-3 ، لأن طفرة أي منهما تقلل التفاعل بشكل كبير. يزيد وجود موقعي ربط 14-3-3 على بولي ببتيد واحد تقارب ربط 14-3-3 بأكثر من 30 ضعفًا (Yaffe وآخرون.، 1997) ، والعديد من الأهداف 14-3-3 ، مثل DAF-16 (Cahill وآخرون.، 2001) و Cdc25B (جايلز وآخرون.، 2003) ، يتطلب وجود أكثر من موقع ربط واحد لترابط مستقر 14-3-3. بالنظر إلى الطبيعة القاتمة لـ 14-3-3 ، يوجد احتمال أن يرتبط جزيء DYRK1A بثنائي 14-3-3 من خلال التلامس بين عزر phospho-Ser-520 ومونومر واحد 14-3-3 وبين الثاني شكل ملزم عند الطرف N والمونومر الآخر. استنادًا إلى حقيقة أن منطقة DYRK1A N-terminal قادرة على الارتباط بـ 14-3-3 عند اندماجها في بروتين غير متجانس ، ولكن ليس في سياق طفرة Ser-520 ، نقترح أن 14-3-3 يمكن أولاً التعرف على فكرة phospho-Ser-520 والربط بها ، مما يسهل الارتباط بموقع الربط 14-3-3 الآخر في الطرف N ، مما يؤدي إلى استقرار المجمع.

      بالإضافة إلى 14-3-3β ، وجدنا أن DYRK1A يمكنه أيضًا ربط 14-3-3η (الشكل التكميلي S7). حدد تحليلان بروتينيان حديثان DYRK1A كأحد البروتينات الموجودة في مجمعات 14-3-3 من الأشكال الإسوية γ و σ (جين وآخرون.، 2004 بنزنجر وآخرون.، 2005) وكيم وآخرون. (2004) أبلغت عن تفاعل مع الشكل الإسوي 14-3-3ε. على الرغم من أن هذه البيانات تشير إلى أن DYRK1A قادر على التفاعل مع العديد من الأشكال الإسوية 14-3-3 ، ستكون هناك حاجة إلى مزيد من التحقيق لتحديد ما إذا كان هناك أي انتقائية في تفاعلات DYRK1A / 14-3-3.

      يبدو أن حالة الفسفرة لبعض الأشكال الإسوية 14-3-3 ، بما في ذلك الشكل الإسوي β ، تنظم كلاً من التثبيط والربط المستهدف (Yoshida وآخرون.، 2005). وبالتالي ، قمنا بفحص ما إذا كان DYRK1A يمكن أن يكون بمثابة 14-3-3 كيناز مفترض. لم نعثر على فسفرة كبيرة من 14-3-3β بواسطة فحوصات المختبر كيناز (الشكل التكميلي S8) ، مما يشير إلى أن هذا ليس هو الحال.

      تدعم النتائج الموثقة في هذه المخطوطة فكرة أن فسفرة DYRK1A في Ser-520 هي حدث فسفرة ذاتي داخل الجزيء. لا توجد بقايا Ser الفسفورية في موقع إجماع DYRK1A لا لبس فيه ، نظرًا لوجود Asp بدلاً من Pro في الموضع P + 1 ومع ذلك ، فإن وجود Arg عند P − 3 سوف يستوعب تفضيلات DYRK1A في هذا الموضع (Himpel وآخرون.، 2000). تجدر الإشارة إلى أن تعريف تسلسل الفسفرة الإجماعي لـ DYRK1A استند إلى التفاعلات الجزيئية على الببتيدات ، ومن المتصور أن متطلبات التسلسل الأخرى ضرورية لتفاعلات الفسفرة الذاتية داخل الجزيئية.

      لا تتداخل حالة الفسفرة في Ser-520 مع الفسفرة الذاتية لـ Tyr ، مما يشير إلى أنه من المحتمل جدًا أن تكون حلقة تنشيط DYRK1A حدثًا سابقًا. علاوة على ذلك ، يمكننا اكتشاف فسفرة DYRK1A الذاتية على Ser-520 في الجسم الحي. وهكذا ، بصرف النظر عن Tyr-321 من حلقة التنشيط ، يمثل Ser-520 الفوسفوزيت الوحيد في الجسم الحي DYRK1A الذي تم تحديده حتى الآن.

      في الاعتبار الأول ، قد يُفترض أن حدث الفسفرة الذاتية هو مقياس متكافئ ، لكن أنماط اللطخة المناعية لمجموع DYRK1A و pS520 لم تكن متكافئة تمامًا عندما تم التعبير عن كيناز خارجيًا في خلايا الثدييات والبكتيريا. علاوة على ذلك ، كانت مستويات الفسفرة في Ser-520 أقل في خلايا الثدييات عنها في البروتين المعبر عنه بالبكتيريا ، حيث تراوحت بين 10 إلى 40 ٪ من البروتين المؤتلف. قادنا هذا إلى الاعتقاد بأنه لم تتم فسفرة كل جزيئات DYRK1A في الجسم الحي. يتم دعم هذا الاقتراح من خلال التغييرات الديناميكية في مستوى فسفرة Ser-520 لـ DYRK1A الذاتية التي لوحظت استجابة لتحفيز bFGF. على الرغم من أننا لا نستطيع استبعاد احتمال أن تؤثر إشارات bFGF على نشاط الفسفرة الذاتية نفسه ، يبدو أنه من المرجح أن تؤثر الإشارات على استقرار سير -520 الفسفوري. يمكن تحقيق ذلك من خلال تنشيط Ser-520 فوسفاتيز و / أو عن طريق إعاقة ربط 14-3-3 ، والذي يمكن أن يحمي Ser-520 من نزع الفسفرة ، كما تم الإبلاغ مؤخرًا عن Ser-526 في بروتين كيناز كيناز المنشط بالميتوجين كيناز 3 (ميك 3) (فريتز وآخرون., 2006).

      من النتائج المثيرة للاهتمام بشكل خاص للتفاعل بين DYRK1A و 14-3-3 التنظيم الإيجابي لنشاط كيناز DYRK1A. يبدو أن 14-3-3β يزيد من النشاط الحفاز لـ DYRK1A المؤتلف فقط تجاه الركائز الخارجية ، لأنه لم يتم اكتشاف أي تأثير على الفسفرة الذاتية DYRK1A (الشكل التكميلي 8). ميكانيكيا ، يمكن تصور عدة سيناريوهات. في أحدها ، يتطلب التأثير الربط من خلال كل من مواقع الربط 14-3-3 ، بما يتوافق مع النموذج الذي يمكن أن يؤدي فيه ربط dimeric 14-3-3 إلى موقعين ملزمين على DYRK1A إلى تغيير توافقي في DYRK1A مما يعزز النشاط الأنزيمي. تم اقتراح هذه الآلية للأنزيمات الأخرى التي يتم تنظيمها بواسطة بروتينات 14-3-3 ، مثل ن-اسيتيل ترانسفيراز (أوبسيل وآخرون.، 2001). بدلاً من ذلك ، تعمل المنطقة الطرفية N كمتطلب هيكلي لتحقيق الاستقرار في التشكل الأكثر نشاطًا ، بالاتفاق مع النشاط التحفيزي الأساسي المنخفض للطفرة المحذوفة N-terminal تجاه الركائز الخارجية. في هذا السياق ، سيشغل DYRK1A موقعًا واحدًا فقط من مواقع الربط في dimer 14-3-3 ، تاركًا الآخر متاحًا لتجنيد ركائز أو مؤثرات DYRK1A. تم الإبلاغ عن هذا ، على سبيل المثال ، لأحد مواقع الربط 14-3-3 في بروتينات Raf ، حيث يعمل 14-3-3 كسقالة تتوسط في التغاير بين حركات C-Raf و B-Raf (Garnett وآخرون.، 2005). في هذا الصدد ، من الجدير بالذكر أن تاو و FKHR ، وهما هدفان مشهوران 14-3-3 ، هما ركائز DYRK1A (الغابة وآخرون., 2001).

      تم الإبلاغ عن عدد قليل فقط من kinases التي تربط 14-3-3 لتعديل نشاطها نتيجة لهذا التفاعل (الجدول 1). في جميع الحالات ، يعتمد الربط 14-3-3 على شكل فسفوري. يمكن أن تحدث البقايا المفسفرة داخل أو خارج المجال التحفيزي ، ويمكن أن يؤدي الارتباط 14-3-3 إما إلى تثبيط أو تنشيط نشاط كيناز. على الرغم من أنه في بعض الحالات يتم التوسط في الفسفرة في أشكال الربط 14-3-3 بواسطة كيناز المنبع ، إلا أن هناك ثلاثة كينازات أخرى ، بالإضافة إلى DYRK1A ، حيث يُعرف الارتباط بـ 14-3-3 بأنه يتم تنظيمه بواسطة الفسفرة الذاتية. في حالة MEKK3 (Fritz وآخرون.، 2006) و 3-فوسفوينوزيتيد المعتمد على البروتين كيناز 1 (Sato وآخرون.، 2002) ، يتم تغيير النشاط التحفيزي عن طريق الارتباط 14-3-3 ببقايا ذاتية الفسفرة داخل حلقة التنشيط. بالنسبة لبروتين كيناز C (PKC) μ ، فإن الارتباط 14-3-3 ضمن المجال التنظيمي C1 يمنع نشاط PKC كيناز (Hausser وآخرون.، 1999). وبالتالي ، على حد علمنا ، يمثل DYRK1A الحالة الوحيدة التي تؤدي فيها الفسفرة الذاتية لموقع خارج المجال التحفيزي إلى نشاط كيناز محسن عند الارتباط 14-3-3. علاوة على ذلك ، يبدو أن هذه الآلية خاصة بـ DYRK1A ، لأن نموذج Ser-520 غير محفوظ في أعضاء آخرين من عائلة DYRK.

      الجدول 1. تأثير ارتباط 14-3-3 على نشاط كينازات بروتين الثدييات


      شاهد الفيديو: Gel electrophoresis. Chemical processes. MCAT. Khan Academy (قد 2022).