معلومة

كيف تعمل شوكات النسخ المتعددة دون "الاصطدام" ، وما فائدة هذه الطريقة؟

كيف تعمل شوكات النسخ المتعددة دون


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أقرأ حاليًا القليل عن تكرار الحمض النووي ، وقد جئت عبر البيان التالي ؛

يبدأ النسخ المتماثل من نقطة ثابتة وهو ثنائي الاتجاه ... في حقيقيات النوى ، هناك العديد من شوكات النسخ المتماثل ، كل منها يتقدم بطريقة ثنائية الاتجاه.

إذا كان هناك خيط طويل واحد من الحمض النووي في خلية حقيقية النواة ، أرى مشاكل محتملة في هذا:

تتضمن هذه الشوكات فتح قسم من الحمض النووي مزدوج الشريطة ، وتصبح كل خصلة شريطاً مزدوجاً في قطعة DNA مركبة حديثاً. في مرحلة ما ، قبل أن تصبح أي شوكة مفردة جزيئين جديدين مزدوجي الشريطة ، يمكن أن "تصطدم" شوكة أخرى بهذا ، مما يجعلها تحاول تكرار الجزء غير النهائي.

ببساطة ، كيف يمكن لشوكة النسخ المتماثل أن تلتقي بأخرى دون زيادة عدد السلاسل التي يتم تكرارها بشكل كبير؟

أيضًا ، على مستوى أكثر عمومية ، سأكون مهتمًا جدًا بمعرفة الفائدة الفعلية من هذا ، عندما تحتاج ، عادةً ، فقط نسخة واحدة من الجزيء المزدوج الشريطة إلى صنع.


للوصول إلى العدد المتزايد بشكل كبير من السلاسل ، يجب أن يبدأ النسخ المتماثل على الخيط المنسوخ بالفعل ، وليس على الخيط الأصلي. يتم التحكم بشدة في النسخ المتماثل في حقيقيات النوى ويتم منع مثل هذا الحدث من خلال التنظيم.

كيف يمكن للخلية أن تمنع إعادة تكرار الخيط الذي يتم تصنيعه حاليًا؟ من خلال توقيت خطوات النسخ بترتيب صارم ومنع أي نسخ خارج هذا الترتيب.

يبدأ النسخ المتماثل من الأصول المحددة للنسخ المتماثل. في المرحلة G1 ، يتم تجميع مجمعات ما قبل النسخ المتماثل (pre-RCs) في أصول التكرارات. يمكن بدء النسخ المتماثل في مراكز RC السابقة هذه ، ولكن لا يمكن تجميع ما قبل المنسقين المقيمين في المراحل اللاحقة من دورة الخلية. عند بدء النسخ المتماثل ، يتم تحويل ما قبل RC إلى ما بعد RC والذي لا يمكنه بدء النسخ المتماثل بعد الآن ، مما يمنع إعادة النسخ المتماثل.

فائدة الأصول المتعددة للنسخ المتماثل هي سرعة النسخ المتماثل. يمكن أن تكون جينومات حقيقيات النوى أكبر بكثير من تلك الموجودة في البكتيريا البسيطة. سيستغرق تكرارها باستخدام أصل واحد للنسخ المتماثل وقتًا طويلاً جدًا.

بعض مواد القراءة الإضافية:


وجهة نظر: هل حجم الخلية هو spandrel؟

تتحكم جميع الكائنات الحية في حجم خلاياها. نركز هنا على مسألة تنظيم الحجم في البكتيريا ، ونقترح أن القوانين الكمية التي تحكم حجم الخلية واعتمادها على معدل النمو قد تنشأ كنتائج ثانوية لآلية تنظيمية تطورت لدعم شوكات تكرار الحمض النووي المتعددة. على وجه الخصوص ، نوضح أن زيادة حجم الخلية البكتيرية أثناء تجارب التطور طويلة المدى التي أجرتها Lenski هي نتيجة طبيعية لهذا الاقتراح. يشير هذا إلى أنه في سياق التطور ، قد يكون حجم الخلية بمثابة `` spandrel ''


المواد والأساليب

السلالات البكتيرية وظروف النمو

جميع السلالات المستخدمة بكتريا قولونية K-12 والمدرجة في الجدول 1. نمت الخلايا عند درجة الحرارة المحددة (37 درجة مئوية أو 42 درجة مئوية) في وسط LB (LB) (10 جم Tryptone ، 5 جم NaCl ، 250 ميكرولتر 4 M هيدروكسيد الصوديوم / لتر) ، متوسط ​​الحد الأدنى AB (44) مكمل بـ 10 ميكروغرام / مل من الثيامين ، وإما 0.2٪ جلوكوز و 0.5٪ أحماض كازامينية (متوسط ​​الجلوكوز- CAA) ، أو 0.2٪ جلوكوز (وسط الجلوكوز). تم إجراء السلالة IBP05 عن طريق تضخيم جين الكلورامفينيكول باستخدام البادئات 5΄GCGCTAAGAACCATCATTGGCTGTTAAAACATTATTAAAAATGTCAATGGCATGATGAATATCCTCCTAG و 5΄CGATTTTAGCAGACTGATGTACTACTAGTAGCAGACTGATGTAGTACTAGTAGTAGTAGTAGTCC oriC وإدخال هذه القطعة في الكروموسوم كما هو موصوف في (45). تم إجراء جميع السلالات الأخرى التي تم إنشاؤها لهذا العمل بواسطة توصيل P1 (46) ، كما هو موضح في الجدول 1. recBC تم التحقق من طفرات Ts من خلال حساسيتها للإشعاع فوق البنفسجي ، ولكن seqA2 و seqA4 تم التحقق من الطفرات عن طريق التسلسل بسبب انخفاض معدل التحويل المشترك لجين علامة المقاومة والطفرة. ال oriCm3 تم التحقق من المسوخ من خلال النمط الظاهري غير المتزامن كما هو محدد بواسطة قياس التدفق الخلوي.

سلالات

أضنى . الميزات ذات الصلة. مصدر .
MG1655 النوع البري ( 80, 81)
AB1157 النوع البري ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3كام هذا العمل
UF340 seqA2( 20)
UF301 سد seqA413( 20)
CAG18433 asnB3057 :: Tn10( 83)
SF169 UF301 asnB3057 :: Tn10UF301 × P1 CAG18433
N1331 النوع البري ( 84)
N1332 recA ت ( 80, 81, 84)
NL40 DS941ديفΔ6 :: KmR ( 85)
DS984 DS941xerC:: mini-Mu CmR ( 86)
DS9008 DS941xerD:: mini-Tn10 (-9) ( 87)
SS1211 Δrep:: كام ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (هذا العمل)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (هذا العمل)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (هذا العمل)
SK129 recB270 (تس) recC271 (تس) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (هذا العمل)
IBP01 SK129 seqA2SK129 x P1 UF340 (هذا العمل)
IBP03 SK129 seqA4SK129 x P1 SF169 (هذا العمل)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (هذا العمل)
IBP02 N1332 seqA2N1332 x P1 UF340 (هذا العمل)
IBP06 N1332 seqA4N1332 x P1 SF169 (هذا العمل)
IBP24 N1332 Δrep:: كام N1332 x P1 SS1211 (هذا العمل)
IBP39 MG1655 Δrep:: كام MG1655 x P1 SS1211 (هذا العمل)
IBP40 MG1655 seqA2 Δrep:: كام IBP37 x P1 SS1211 (هذا العمل)
IBP41 MG1655 seqA4 Δrep:: كام IBP38 x P1 SS1211 (هذا العمل)
IBP98 MG1655 oriCm3 Δrep:: كام MG1655oriCm3 x P1 SS1211 (هذا العمل)
IF01 recA938:: كام ( 88)
IBP87 MG1655 recA938:: كام MG1655 x P1 IF01 (هذا العمل)
IBP80 MG1655 seqA2 recA938:: كام IBP37 x P1 IF01 (هذا العمل)
IBP81 MG1655 seqA4 recA938:: كام IBP38 x P1 IF01 (هذا العمل)
IBP100 MG1655 oriCm3 recA938:: كام MG1655oriCm3 x P1 IF01 (هذا العمل)
IBP88 MG1655 ديفΔ6 :: KmR MG1655 x P1 NL40 (هذا العمل)
IBP85 MG1655 seqA2 ديفΔ6 :: KmR IBP37 x P1 NL40 (هذا العمل)
IBP82 MG1655 seqA4 ديفΔ6 :: KmR IBP38 x P1 NL40 (هذا العمل)
IBP101 MG1655 oriCm3 difΔ6 :: KmR MG1655oriCm3 x P1 NL40 (هذا العمل)
IBP89 MG1655 xerC:: mini-Mu CmR MG1655 x P1 DS984 (هذا العمل)
IBP74 MG1655 seqA2 xerC:: mini-Mu CmR IBP37 x P1 DS984 (هذا العمل)
IBP83 MG1655 seqA4 xerC:: mini-Mu CmR IBP38 x P1 DS984 (هذا العمل)
IBP90 MG1655 xerD:: mini-Tn10 (-9) MG1655 x P1 DS9008 (هذا العمل)
IBP68 MG1655 seqA2 xerD:: mini-Tn10 (-9) IBP37 x P1DS9008 (هذا العمل)
IBP84 MG1655 seqA4 xerD:: mini-Tn10 (-9) IBP38 x P1 DS9008 (هذا العمل)
SMR14323 MG1655 ΔaraBAD567 Δattλ :: PBAD zfd2509.2 :: PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ :: PN25tetR FRT ΔattλTn7 :: FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
أضنى . الميزات ذات الصلة. مصدر .
MG1655 النوع البري ( 80, 81)
AB1157 النوع البري ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3كام هذا العمل
UF340 seqA2( 20)
UF301 سد seqA413( 20)
CAG18433 asnB3057 :: Tn10( 83)
SF169 UF301 asnB3057 :: Tn10UF301 x P1 CAG18433
N1331 النوع البري ( 84)
N1332 recA ت ( 80, 81, 84)
NL40 DS941ديفΔ6 :: KmR ( 85)
DS984 DS941xerC:: mini-Mu CmR ( 86)
DS9008 DS941xerD:: mini-Tn10 (-9) ( 87)
SS1211 Δrep:: كام ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (هذا العمل)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (هذا العمل)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (هذا العمل)
SK129 recB270 (تس) recC271 (تس) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (هذا العمل)
IBP01 SK129 seqA2SK129 x P1 UF340 (هذا العمل)
IBP03 SK129 seqA4SK129 x P1 SF169 (هذا العمل)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (هذا العمل)
IBP02 N1332 seqA2N1332 x P1 UF340 (هذا العمل)
IBP06 N1332 seqA4N1332 x P1 SF169 (هذا العمل)
IBP24 N1332 Δrep:: كام N1332 x P1 SS1211 (هذا العمل)
IBP39 MG1655 Δrep:: كام MG1655 x P1 SS1211 (هذا العمل)
IBP40 MG1655 seqA2 Δrep:: كام IBP37 x P1 SS1211 (هذا العمل)
IBP41 MG1655 seqA4 Δrep:: كام IBP38 x P1 SS1211 (هذا العمل)
IBP98 MG1655 oriCm3 Δrep:: كام MG1655oriCm3 x P1 SS1211 (هذا العمل)
IF01 recA938:: كام ( 88)
IBP87 MG1655 recA938:: كام MG1655 x P1 IF01 (هذا العمل)
IBP80 MG1655 seqA2 recA938:: كام IBP37 x P1 IF01 (هذا العمل)
IBP81 MG1655 seqA4 recA938:: كام IBP38 x P1 IF01 (هذا العمل)
IBP100 MG1655 oriCm3 recA938:: كام MG1655oriCm3 x P1 IF01 (هذا العمل)
IBP88 MG1655 ديفΔ6 :: KmR MG1655 x P1 NL40 (هذا العمل)
IBP85 MG1655 seqA2 ديفΔ6 :: KmR IBP37 x P1 NL40 (هذا العمل)
IBP82 MG1655 seqA4 ديفΔ6 :: KmR IBP38 x P1 NL40 (هذا العمل)
IBP101 MG1655 oriCm3 difΔ6 :: KmR MG1655oriCm3 x P1 NL40 (هذا العمل)
IBP89 MG1655 xerC:: mini-Mu CmR MG1655 x P1 DS984 (هذا العمل)
IBP74 MG1655 seqA2 xerC:: mini-Mu CmR IBP37 x P1 DS984 (هذا العمل)
IBP83 MG1655 seqA4 xerC:: mini-Mu CmR IBP38 x P1 DS984 (هذا العمل)
IBP90 MG1655 xerD:: mini-Tn10 (-9) MG1655 x P1 DS9008 (هذا العمل)
IBP68 MG1655 seqA2 xerD:: mini-Tn10 (-9) IBP37 x P1DS9008 (هذا العمل)
IBP84 MG1655 seqA4 xerD:: mini-Tn10 (-9) IBP38 x P1 DS9008 (هذا العمل)
SMR14323 MG1655 ΔaraBAD567 Δattλ :: PBAD zfd2509.2 :: PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ :: PN25tetR FRT ΔattλTn7 :: FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
أضنى . الميزات ذات الصلة. مصدر .
MG1655 النوع البري ( 80, 81)
AB1157 النوع البري ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3كام هذا العمل
UF340 seqA2( 20)
UF301 سد seqA413( 20)
CAG18433 asnB3057 :: Tn10( 83)
SF169 UF301 asnB3057 :: Tn10UF301 x P1 CAG18433
N1331 النوع البري ( 84)
N1332 recA ت ( 80, 81, 84)
NL40 DS941ديفΔ6 :: KmR ( 85)
DS984 DS941xerC:: mini-Mu CmR ( 86)
DS9008 DS941xerD:: mini-Tn10 (-9) ( 87)
SS1211 Δrep:: كام ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (هذا العمل)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (هذا العمل)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (هذا العمل)
SK129 recB270 (تس) recC271 (تس) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (هذا العمل)
IBP01 SK129 seqA2SK129 x P1 UF340 (هذا العمل)
IBP03 SK129 seqA4SK129 x P1 SF169 (هذا العمل)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (هذا العمل)
IBP02 N1332 seqA2N1332 x P1 UF340 (هذا العمل)
IBP06 N1332 seqA4N1332 x P1 SF169 (هذا العمل)
IBP24 N1332 Δrep:: كام N1332 x P1 SS1211 (هذا العمل)
IBP39 MG1655 Δrep:: كام MG1655 x P1 SS1211 (هذا العمل)
IBP40 MG1655 seqA2 Δrep:: كام IBP37 x P1 SS1211 (هذا العمل)
IBP41 MG1655 seqA4 Δrep:: كام IBP38 x P1 SS1211 (هذا العمل)
IBP98 MG1655 oriCm3 Δrep:: كام MG1655oriCm3 x P1 SS1211 (هذا العمل)
IF01 recA938:: كام ( 88)
IBP87 MG1655 recA938:: كام MG1655 x P1 IF01 (هذا العمل)
IBP80 MG1655 seqA2 recA938:: كام IBP37 x P1 IF01 (هذا العمل)
IBP81 MG1655 seqA4 recA938:: كام IBP38 x P1 IF01 (هذا العمل)
IBP100 MG1655 oriCm3 recA938:: كام MG1655oriCm3 x P1 IF01 (هذا العمل)
IBP88 MG1655 ديفΔ6 :: KmR MG1655 x P1 NL40 (هذا العمل)
IBP85 MG1655 seqA2 ديفΔ6 :: KmR IBP37 x P1 NL40 (هذا العمل)
IBP82 MG1655 seqA4 ديفΔ6 :: KmR IBP38 x P1 NL40 (هذا العمل)
IBP101 MG1655 oriCm3 difΔ6 :: KmR MG1655oriCm3 x P1 NL40 (هذا العمل)
IBP89 MG1655 xerC:: mini-Mu CmR MG1655 x P1 DS984 (هذا العمل)
IBP74 MG1655 seqA2 xerC:: mini-Mu CmR IBP37 x P1 DS984 (هذا العمل)
IBP83 MG1655 seqA4 xerC:: mini-Mu CmR IBP38 x P1 DS984 (هذا العمل)
IBP90 MG1655 xerD:: mini-Tn10 (-9) MG1655 x P1 DS9008 (هذا العمل)
IBP68 MG1655 seqA2 xerD:: mini-Tn10 (-9) IBP37 x P1DS9008 (هذا العمل)
IBP84 MG1655 seqA4 xerD:: mini-Tn10 (-9) IBP38 x P1 DS9008 (هذا العمل)
SMR14323 MG1655 ΔaraBAD567 Δattλ :: PBAD zfd2509.2 :: PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ :: PN25tetR FRT ΔattλTn7 :: FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
أضنى . الميزات ذات الصلة. مصدر .
MG1655 النوع البري ( 80, 81)
AB1157 النوع البري ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3كام هذا العمل
UF340 seqA2( 20)
UF301 سد seqA413( 20)
CAG18433 asnB3057 :: Tn10( 83)
SF169 UF301 asnB3057 :: Tn10UF301 x P1 CAG18433
N1331 النوع البري ( 84)
N1332 recA ت ( 80, 81, 84)
NL40 DS941ديفΔ6 :: KmR ( 85)
DS984 DS941xerC:: mini-Mu CmR ( 86)
DS9008 DS941xerD:: mini-Tn10 (-9) ( 87)
SS1211 Δrep:: كام ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (هذا العمل)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (هذا العمل)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (هذا العمل)
SK129 recB270 (تس) recC271 (تس) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (هذا العمل)
IBP01 SK129 seqA2SK129 x P1 UF340 (هذا العمل)
IBP03 SK129 seqA4SK129 x P1 SF169 (هذا العمل)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (هذا العمل)
IBP02 N1332 seqA2N1332 x P1 UF340 (هذا العمل)
IBP06 N1332 seqA4N1332 x P1 SF169 (هذا العمل)
IBP24 N1332 Δrep:: كام N1332 x P1 SS1211 (هذا العمل)
IBP39 MG1655 Δrep:: كام MG1655 x P1 SS1211 (هذا العمل)
IBP40 MG1655 seqA2 Δrep:: كام IBP37 x P1 SS1211 (هذا العمل)
IBP41 MG1655 seqA4 Δrep:: كام IBP38 x P1 SS1211 (هذا العمل)
IBP98 MG1655 oriCm3 Δrep:: كام MG1655oriCm3 x P1 SS1211 (هذا العمل)
IF01 recA938:: كام ( 88)
IBP87 MG1655 recA938:: كام MG1655 x P1 IF01 (هذا العمل)
IBP80 MG1655 seqA2 recA938:: كام IBP37 x P1 IF01 (هذا العمل)
IBP81 MG1655 seqA4 recA938:: كام IBP38 x P1 IF01 (هذا العمل)
IBP100 MG1655 oriCm3 recA938:: كام MG1655oriCm3 x P1 IF01 (هذا العمل)
IBP88 MG1655 ديفΔ6 :: KmR MG1655 x P1 NL40 (هذا العمل)
IBP85 MG1655 seqA2 ديفΔ6 :: KmR IBP37 x P1 NL40 (هذا العمل)
IBP82 MG1655 seqA4 ديفΔ6 :: KmR IBP38 x P1 NL40 (هذا العمل)
IBP101 MG1655 oriCm3 difΔ6 :: KmR MG1655oriCm3 x P1 NL40 (هذا العمل)
IBP89 MG1655 xerC:: mini-Mu CmR MG1655 x P1 DS984 (هذا العمل)
IBP74 MG1655 seqA2 xerC:: mini-Mu CmR IBP37 x P1 DS984 (هذا العمل)
IBP83 MG1655 seqA4 xerC:: mini-Mu CmR IBP38 x P1 DS984 (هذا العمل)
IBP90 MG1655 xerD:: mini-Tn10 (-9) MG1655 x P1 DS9008 (هذا العمل)
IBP68 MG1655 seqA2 xerD:: mini-Tn10 (-9) IBP37 x P1DS9008 (هذا العمل)
IBP84 MG1655 seqA4 xerD:: mini-Tn10 (-9) IBP38 x P1 DS9008 (هذا العمل)
SMR14323 MG1655 ΔaraBAD567 Δattλ :: PBAD zfd2509.2 :: PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ :: PN25tetR FRT ΔattλTn7 :: FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (هذا العمل)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (هذا العمل)

تحضير الحمض النووي في سدادات الاغاروز من أجل الرحلان الكهربائي للهلام النبضي

الثقافات بين عشية وضحاها من recBC تم تخفيف سلالات (Ts) عند 22 درجة مئوية (درجة الحرارة المسموح بها) إلى كثافة بصرية (OD600) من 0.005 ونمت عند 42 درجة مئوية (درجة حرارة غير مسموح بها) في وسط LB إلى OD600 0.15 (المرحلة الأسية). تم طرد حجم الثقافة المقابلة لحوالي 2.5 × 10 8 خلايا (Coulter Counter Multisizer ، Beckman) وتم تعليقه مرتين في Tris / NaCl (10 ملي مولار تريس- حمض الهيدروكلوريك ، الأس الهيدروجيني 7.6 ، 1 م كلوريد الصوديوم) (في البداية 1 مل). تم إحضار كميات متساوية من تعليق الخلية (معلق في Tris / NaCl) و agarose المقطوع النظيف المنصهر (Bio-Rad) إلى 42 درجة مئوية وتم دمجها. تم توزيع ما مجموعه 90 ميكرولتر من تعليق agarose / الخلية على آبار القوالب التي يمكن التخلص منها (Bio-Rad) ، وتم ترسيخها وطردها في أنبوب سعة 50 مل يحتوي على 2.5 مل من محلول تحلل EC (6 ملي مولار تريس - حمض الهيدروكلوريك ، ودرجة الحموضة 7.6 ، 1 م. كلوريد الصوديوم ، 100 ملي EDTA ، معدلة إلى الأس الهيدروجيني 7.6 مع هيدروكسيد الصوديوم ، 1٪ ن- لوريل ساركوزين ، 1 ملغ / مل من الليزوزيم و 20 ميكروغرام / مل من RNase A) ، وحضنت طوال الليل عند 37 درجة مئوية. بعد إزالة محلول تحلل EC ، تم شطف السدادات باستخدام محلول TE (10 ملي مولار من حمض الهيدروكلوريك ، ودرجة الحموضة 8.0 ، 1 ملي مولار EDTA ، ودرجة الحموضة 8.0) وأضيف 2.5 مل من محلول ESP (500 ملي مولار EDTA (تم ضبطه على الرقم الهيدروجيني 9-9.5) مع هيدروكسيد الصوديوم) ، 1٪ ن- لوريل ساركوزين ، بروتيناز ك (50 ميكروغرام / مل)) ، يليه حضانة عند 37 درجة مئوية طوال الليل (أو 48-72 ساعة). تم بعد ذلك غسل السدادات باستخدام محلول TE عند 25 درجة مئوية ، مع ثلاث غسلات مدة كل منها ساعتين باستخدام محلول عازلة 30 مل TE. تم اتخاذ الخطوات المذكورة أعلاه من بروتوكول قياسي لإعداد المقابس من أجل الرحلان الكهربائي للهلام النبضي (PFGE) للحمض النووي البكتيري (47).

CHEF-DR III PFGE والقياس الكمي

تم استخدام نظام الفصل الكهربائي للمجال النبضي CHEF-DR III (Bio-Rad) لحل الحمض النووي. تم ضبط وقت التشغيل على 21 ساعة وكانت درجة الحرارة 14 درجة مئوية ، وكانت أوقات التبديل الأولية والنهائية 60 و 120 ثانية ، على التوالي ، تم ضبط فولت / سم على 6 ، وكانت الزاوية المضمنة 120 و 0.5 × TBE تم استخدامها كمخزن مؤقت للتشغيل. تم تلطيخ الجل بعد ذلك باستخدام SYBR Gold Nucleic Acid Gel Stain (تقنيات الحياة) وتم قياسه باستخدام برنامج Genetool (Syngene) مع طريقة القرص المتداول لطرح الخلفية. يعطي SYBR Gold Nucleic Acid Gel Stain (تقنيات الحياة) علاقة خطية بين كثافة التألق ومحتوى الحمض النووي على الأقل مرتين من حيث الحجم (48) ، كما تم تطبيقه سابقًا أيضًا (49). تم العثور على النسبة المئوية لتفتت الكروموسومات عن طريق قياس الحمض النووي الموجود في البئر وتحت البئر مباشرة (DNA غير مجزأ والكروموسومات على الأرجح مع شق واحد ، على التوالي) ثم قياس الحمض النووي في بقية الممر. ثم تم تقسيم قيمة الحمض النووي المجزأ على القيمة الإجمالية للحمض النووي. القياس الكمي للتجزئة الكروموسومية لـ a مندوب recBC متحولة مع هذه الطريقة كانت متفقة مع النتائج المنشورة بالفعل (50٪) (14).

قياس التدفق الخلوي وتفسير الرسوم البيانية للحمض النووي

نمت الخلايا أضعافا مضاعفة لعدة أجيال لضمان نمو متوازن. عند OD 0.15 ، تم حصاد الخلايا المتنامية بشكل أسي إما مباشرة أو معالجتها بريفامبيسين (300 ميكروغرام / مل) وسيفاليكسين (10 ميكروغرام / مل) لفترة زمنية تعادل ثلاثة إلى أربعة أجيال قبل الحصاد. تم إعادة تعليق كل من الخلايا التي تم حصادها ومعالجتها مباشرة في محلول TE (10 ملي مولار تريس- حمض الهيدروكلوريك ، درجة الحموضة 8.0 ، 1 ملي مولار EDTA ، درجة الحموضة 8.0) وتم تثبيتها في 70 ٪ من الإيثانول. تم استخدام الفلوريسين أيزوثيوسيانات (FITC ، Sigma-Aldrich) (50) لتلوين البروتين (يمثل الكتلة) ، وتم استخدام Hoechst 33258 لتلوين الحمض النووي (Sigma-Aldrich) (51). تم إجراء قياس التدفق الخلوي باستخدام مقياس التدفق الخلوي LSR-II المزود بليزر أيون الأرجون 488 نانومتر وليزر كريبتون 355 نانومتر (BD Biosciences) ، وتم تحليل النتائج باستخدام برنامج FlowJo (Tree Star ، Inc.).

يمنع الريفامبيسين والسيفاليكسين بدء التكاثر والانقسام الخلوي ، على التوالي. لا يمكن للخلايا بدء جولة جديدة من النسخ المتماثل بعد إضافة هذه الأدوية ولكن يمكنها إكمال جولات التكرار المستمرة (دون الانقسام). تعطي الرسوم البيانية للحمض النووي للخلايا المعالجة عددًا صحيحًا من الكروموسومات لكل خلية بقيم 2 ن أو 2 ن+1 أين ن = 0 ، 1 ، 2 ، 3 ... يمثل الجيل الذي يحدث فيه البدء. ومع ذلك ، فإن هذا النمط ينطبق فقط على الخلايا ذات البدء المتزامن للنسخ المتماثل (إطلاق جميع الأصول في وقت واحد) والإكمال الناجح لاستطالة النسخ المتماثل (جميع الشوكات التي بدأت تصل إلى النهاية). ستحتوي أيضًا الرسوم البيانية للحمض النووي للخلايا التي تظهر بدايات غير متزامنة على أعداد غير منتظمة من الكروموسومات (مثل 3 ، 5 ، 7 ، إلخ) ، وستُنظر إلى مشاكل استطالة النسخ المتماثل على أنها نقص في القمم المميزة في الحمض النووي `` النفاد '' الرسوم البيانية (أي الرسوم البيانية للخلايا المعالجة بالريفامبيسين والسيفاليكسين).

نفاد النسخ المتماثل في حالة عدم وجود وظيفة RecA

تم تقسيم ثقافات الخلايا التي تنمو بشكل أسي (إلى OD ∼0.15) عند 30 درجة مئوية ، وتمت إضافة ريفامبيسين (450 ميكروغرام / مل) وسيفاليكسين (10 ميكروغرام / مل) إلى كل ثقافة. تم الاحتفاظ بجزء واحد عند درجة الحرارة المسموح بها (30 درجة مئوية) بينما تم تحويل الجزء الآخر إلى درجة الحرارة غير المسموح بها (42 درجة مئوية) لفقدان وظيفة RecA. تم حصاد الخلايا قبل العلاج بالعقاقير وبعد 3-4 مرات في وجود الأدوية وتم تثبيتها للتحليل باستخدام قياس التدفق الخلوي لمقارنة نفاد شوكة النسخ المتماثل عند كل درجة حرارة. تم تحليل الرسوم البيانية للتدفق باستخدام برنامج FlowJo (Tree Star ، Inc.). تم الحصول على متوسط ​​الانخفاض لكل خلية في عدد الكروموسومات من خلال تحديد عدد الخلايا في كل ذروة كروموسوم أولاً ، وضرب هذه القيمة في كل عدد كروموسوم للحصول على العدد الإجمالي للكروموسومات ، وبالتالي قسمة ذلك على العدد الإجمالي للكروموسومات. عد الخلايا. تم عد ما مجموعه 50000 خلية لتقدير صحيح لمتوسط ​​عدد الكروموسومات / الخلية. أخيرًا ، تمت مقارنة العدد الإجمالي للكروموسومات عند درجات الحرارة المتساهلة وغير المسموح بها.

اختبارات الجدوى

تم تخفيف الثقافات الليلية بشكل متسلسل باستخدام وسط نمو أو 1 ٪ كلوريد الصوديوم إلى نفس OD تقريبًا. تم رصد ما مجموعه 5 ميكرولتر من التخفيفات التي تتراوح من 10 2 إلى 10 6 على ألواح أجار (نوع أجار المشار إليه في الأشكال).

تحريض Gam-GFP ، التصوير المجهري الفلوري والتدفق الخلوي لـ GFP

نمت الخلايا إلى OD ∼ 0.15 قبل إحداث Gam-GFP بإضافة 10 نانوغرام / مل أنهيدروتتراسيكلين. استمر النمو لمدة 60 دقيقة ، وفي ذلك الوقت تم تجميد الخلايا على وسادة agarose مقاس 17 × 28 مم (1 ٪ تحتوي على محلول ملحي مخزّن بالفوسفات (PBS) مع 10 نانوغرام / مل من أنهيدروتتراسيكلين) ومغطاة بـ no. 1.5 ساترة. تم الحصول على الصور باستخدام مجهر Leica DM6000 المجهز بمصباح هاليد معدني Leica EL6000 وكاميرا Hamamatsu ImagEM 1k. تم إجراء تصوير تباين الطور بهدف HCX PL APO 100 × / 1.40 NA. تم إجراء التصوير الفلوري باستخدام مجموعات مرشحات تمرير النطاق الضيق (الإثارة عند BP 470/40 والانبعاث عند BP 525/50 لـ GFP).

في تجارب الفحص المجهري الفلوري ، تم الحرص على استخدام نفس الإعدادات بالضبط لتصوير GFP من النوع البري و seqA الخلايا الطافرة (على سبيل المثال نفس الشدة ، وقت التعرض) لتجنب سوء التفسير. باستخدام برنامج ImageJ المتاح للجمهور ، في المعالجة اللاحقة ، قمنا بضبط السطوع / التباين فقط ، مع القيام بذلك بنفس قيم القطع بالضبط لصور seqA المسوخ والخلايا البرية.

تم إجراء قياس التدفق الخلوي لـ Gam-GFP باستخدام Accuri C6 (BD Biosciences) ، وتم تحليل النتائج باستخدام برنامج FlowJo (Tree Star ، Inc.). نمت الخلايا كما هو موصوف أعلاه في وسط الجلوكوز- CAA مع تحريض لمدة 60 دقيقة من Gam-GFP (10 نانوغرام / مل أنهيدروتتراسيكلين) ، تم حصادها وغسلها في برنامج تلفزيوني مباشرة قبل التحليل باستخدام قياس التدفق الخلوي. تم تسجيل ما مجموعه 50000 خلية لكل عينة.

الفحص المجهري للنيوكليودات

تم تلوين نيوكليودات الخلايا الثابتة باستخدام Hoechst 33258 وتم تصورها باستخدام الفحص المجهري الفلوري ، كما هو موضح في (52).


Bchem218 نهائي

1) تحويل أجزاء من الحمض النووي من الكروموسوم البكتيري ذي الأهمية إلى بكتيريا ترميز AmpR ، 2) صفيحة هذه البكتيريا على وسائط الأمبيسلين ، 3) أي
يجب أن تحتوي البكتيريا المحولة التي تنمو على وسط الأمبيسلين على أصل وظيفي من الكروموسوم البكتيري محل الاهتمام ، والذي يمكن الآن التعرف عليه بسهولة
بالتسلسل.

1) تحويل الكروموسوم البكتيري إلى بكتيريا تفتقر إلى AmpR ، 2) محولات الألواح على وسائط الأمبيسلين ، 3) أي بكتيريا متحولة تنمو عليها
يجب أن تحتوي وسائط الأمبيسلين على أصل وظيفي من البكتيريا ذات الأهمية ، والتي يمكن الآن التعرف عليها بسهولة عن طريق التسلسل.

1) إزالة الأصل من البلازميد الذي يحتوي على علامة قابلة للتحديد مثل AmpR ، 2) ربط في أجزاء من الحمض النووي الناتج عن هضم البكتيريا
كروموسوم مهم ، 3) تحويل المؤتلفات الناتجة إلى خلايا بكتيرية تفتقر إلى AmpR والصفيحة على وسط الأمبيسيلين ، 4) أي بكتيريا متحولة
يجب أن يحتوي النمو على وسائط الأمبيسلين على أصل وظيفي من الكروموسوم البكتيري محل الاهتمام ، والذي يمكن الآن تحديده بسهولة عن طريق التسلسل.

ط) هضم البلازميد الذي يحتوي على علامة مختارة مثل AmpR ، 2) ربط أجزاء تشفير AmpR من الحمض النووي في الكروموسوم البكتيري محل الاهتمام ، 3)
تحويل المواد المؤتلفة الناتجة إلى بكتيريا تفتقر إلى AmpR والصفيحة على وسط الأمبيسلين ، 4) يجب على أي بكتيريا متحولة تنمو على وسائط الأمبيسلين
تحتوي على أصل وظيفي من البكتيريا ذات الأهمية ، والتي يمكن الآن التعرف عليها بسهولة عن طريق التسلسل.


شكر وتقدير

نحن ممتنون لـ A. Mazin لمشاركته المعلومات المتعلقة بإعداد الركيزة. نشكر P. Janscak (جامعة زيورخ) و D. Orren (كلية الطب بجامعة كنتاكي) لتوفير قسامات من بروتينات WRN و WRN-E84A المنقاة ، على التوالي. نشكر G. de Murcia (École Supérieure de Biotechnologie de Strasbourg) لتوفير التركيبات لإنتاج جزء PARP1. نشكر Y. Ayala على المناقشات الهامة و G. Triolo للمساعدة في إنتاج البروتين المؤتلف. نشكر مرفق أبحاث النانو بكلية الهندسة والعلوم التطبيقية في جامعة واشنطن في سانت لويس ، والتي تعد جزءًا من شبكة البنية التحتية لتقنية النانو الوطنية التي تدعمها مؤسسة العلوم الوطنية الأمريكية بموجب المنحة رقم. ECS-0335765 ، للتصنيع الدقيق واستخدام غرفة نظيفة. نشكر أيضًا مركز الفحص المجهري وتحليل الصور بجامعة زيورخ للمساعدة الفنية في EM. تم دعم هذا العمل بتمويل بدء التشغيل من قسم Doisy للكيمياء الحيوية والبيولوجيا الجزيئية في كلية الطب بجامعة سانت لويس ومركز السرطان بجامعة سانت لويس ومنح من صندوق أبحاث الرئيس بجامعة سانت لويس و Associazione Italiana per la Ricerca sul كانكرو (AIRC10510) إلى AV تمنح المعاهد الوطنية الأمريكية للصحة CA77852 إلى R.J.M. تمنح مؤسسة العلوم الوطنية السويسرية الابن PP0033-114922 و PP00P3-135292 إلى M. ومساهمة من Fonds zur Förderung des Akademischen Nachwuchses (FAN) من Zürcher Universitätsverein (ZUNIV) إلى M. و A.R.C.


مناقشة

يعد تكرار الحمض النووي وإصلاحه عمليتين بيولوجيتين أساسيتين تضمنان تكرارًا دقيقًا للجينوم. لقد أظهرنا سابقًا ارتباطًا مشتركًا بين بروتين mtp53 وبروتينات تكرار الحمض النووي (8). أظهرنا هنا أن mtp53 و PARP1 مرتبطان بتكرار الحمض النووي في خلايا TNBC. علاوة على ذلك ، عزز mtp53 ارتباط PARP1 بالحمض النووي الناشئ في TNBC وتعزيز تكاثر الخلايا. لاحظنا وجود ارتباط إيجابي بين زيادة تعبير p53 و PARP1 في تحليل عينات السرطان من تحليل TCGA و TMA لجميع الأنواع الفرعية من مرضى سرطان الثدي ، مما يشير إلى أن تسجيل mtp53 و PARP كعلامة تنبؤية يمكن أن يكون بمثابة وكيل لـ TNBCs المحتملة التي من شأنها أن تستفيد من العلاج المركب تالازوباريب وتيموزولوميد. تحثنا النتائج التي توصلنا إليها على اقتراح نموذج (انظر الشكل 5 أ) حيث يرتبط mtp53 (الموضح باللون الأخضر) بتكرار الحمض النووي وتجنيد بروتينات MCM (كما هو موضح باللون الأرجواني) و PARP1 (كما هو موضح باللون الأحمر) على الحمض النووي المتكرر المجهد مما يسمح بالنسخ المتماثل. حتى في وجود تلف الحمض النووي ، مما يعزز تكوين الأورام. حصل Talazoparib مؤخرًا على موافقة إدارة الأغذية والعقاقير (FDA) لسرطان الثدي النقيلي مع طفرات BRCA (43). لقد أظهرنا سابقًا أن mtp53 R273H يزيد من قدرة تالازوباريب على حبس PARP1 على الكروماتين (7 ، 8). نقترح أن تعبير mtp53 R273H في TNBC يسمح لعامل PARPi talazoparib بالاشتراك مع temozolomide للحث على موت الخلية بسبب زيادة محاصرة PARP (كما هو موضح باللون الأصفر ، انظر الشكل 5 ب).

نموذج للطفرات R273H p53 و PARP1 و MCM2–7 على تكرار الحمض النووي المعزز لتكوين الأورام مقابل موت الخلايا. ينطوي تنسيق mtp53 R273H و PARP و MCM2-7 على تكرار الحمض النووي على دور في تكوين الأورام. أ، تتفاعل MCM2-7 (أرجواني) و mtp53 R273H (أخضر) و PARP (أحمر) مع تكرار الحمض النووي (1) عند حدوث ضرر ، فهي تساعد في تسهيل الإصلاح الشاذ (2) ، مما يسمح للخلايا بالبقاء على قيد الحياة وتعزيز تكوين الأورام (3). ب، عندما يتم التعامل مع الخلايا عالية التعبير عن PARP و mtp53 (1) مع talazoparib (الأصفر) بالاشتراك مع temozolomide ، يتم حجز PARP عند تكرار الكروماتين ، مما يزيد من تلف الحمض النووي غير المرمم (لبنة 2) ، مما يعزز موت الخلية (3).

يتم تنظيم تكاثر الحمض النووي من خلال العديد من المجمعات البروتينية التي تنظم ترخيص المنشأ والإطلاق (عوامل الترخيص والبدء) ، والفك (الهليكازات) ، والاسترخاء (الإيزوميرات العليا). يزيد GOF mtp53 إطلاق أصل تكرار الحمض النووي (9) ويعامل p53 متحولة Cdc7 (11). بالإضافة إلى ذلك ، فقد ثبت أن mtp53 R273H يسهل تفاعل TopBP1 مع Treslin ، والذي يسببه Cdk2 في ظل الظروف العادية (13). لقد حددنا سابقًا أن mtp53 يتفاعل بشكل مباشر مع عوامل ترخيص النسخ المتماثل MCM في خطوط خلايا سرطان الثدي المتعددة وأورام الفئران مع طفرة القرقعة البشرية المماثلة R175H (Trp53 R172H / R172H المرجع 8). يرتبط الإفراط في التعبير عن MCMs ارتباطًا وثيقًا بقصر البقاء على قيد الحياة لدى مرضى سرطان الثدي (44). يرتبط تنظيم تعبير Cdc7 أثناء تكوين الأورام الثديية بتسريع تقدم دورة الخلية ، وإيقاف تمايز الورم ، وزيادة عدم الاستقرار الجيني ، وتقليل البقاء على قيد الحياة الخالية من الأمراض (45). يؤدي الفسفرة بوساطة Cdc7 إلى بدء تجميع مجمع البدء لإطلاق أصول النسخ المتماثل (12). وبالتالي ، فإن تنظيم كيناز Cdc7 إلى مجمعات ما قبل النسخ المتماثل المسبق هو محدد رئيسي للتحكم في توقيت النسخ المتماثل.

أظهر فحص ألياف الحمض النووي أن الجينات الورمية المنشطة تحفز زيادة في جزء الشوكات المنتهية وعدم تناسق الشوكة ، إلى جانب انخفاض في سرعة شوكة النسخ وزيادة إطلاق الأصل (35). تحفز الجينات الورمية إطلاق أصول النسخ المتماثل الجديدة ، على عكس الأصول التكوينية ، والتي تكون داخل الجين وتؤدي إلى شوكات النسخ المتماثل المعرضة للانهيار (46). يمكن أن يُعزى انهيار الشوكات التي تبدأ من داخل الجينات والأصول التي يسببها الجينات الورمية إلى تعارضات النسخ والنسخ ، والتي تزداد في الخلايا ذات G المختصرة.1 (46). بشكل ملحوظ ، كشف عزل وتسلسل شظايا أوكازاكي على مستوى الجينوم (OK-Seq) عن المشهد الشامل لتكرار الجينوم البشري (47). غالبًا ما تكون مناطق بدء النسخ المتماثل غير مكتوبة ، ومخصبة بالكروماتين المفتوح ومع تقدم شوكة النسخ المتماثل بشكل كبير مع بدء النسخ (47). مطلوب المزيد من العمل لتوضيح دور GOF mtp53 في تكرار الحمض النووي.

تؤدي مثبطات PARP إلى إضعاف النشاط الإنزيمي لإضافة ADP-ribose إلى الركائز ، والذي بدوره يثبط وظيفة PARP في إصلاح استئصال القاعدة وإصلاح كسر الخيط الأحادي واستشعار تلف الحمض النووي (48). تتسبب العديد من مثبطات PARP أيضًا في احتباس البروتين على الكروماتين مما يتسبب في مزيد من تلف الحمض النووي وقتل الخلايا عن طريق تكوين معقدات DNA-PARP السامة (49). تُستخدم مثبطات PARP في سرطانات الثدي والمبيض العائلية والمتفرقة مع الطفرات biallelic في جينات إصلاح الموارد البشرية BRCA1 ، BRCA2، أو PALB2 (49). يؤدي تثبيط وظيفة PARP1 في الانقسام السريع للخلايا السرطانية إلى تراكم فواصل أحادية الخيط مما يؤدي إلى كسر شوكات النسخ المتماثل التي هي في الأساس فواصل حبلا مزدوجة (DSB المرجع 50). لا يتم إصلاح أجهزة DSB التي عادةً ما يتم إصلاحها بواسطة الموارد البشرية في الخلايا التي تعاني من نقص BRCA1. في هذه الدراسة ، أوضحنا أن PARP1 المرتبط بـ mtp53 R273H على الكروماتين و PARylation المحسّن زاد أيضًا من هذا الارتباط. علاوة على ذلك ، تم الكشف عن مستويات أعلى من PARylation في نموذج PDX لسرطان الثدي R273H mtp53 - معربًا عن سرطان الثدي مقارنة بنموذج wtp53 معربًا عن PDX. نظرًا لأن نشاط PARP يرتبط بمستويات PARylation ، فقد يشير اكتشاف المستويات المنخفضة من PAR إلى نشاط منخفض جوهري لـ PARP مع سمية محدودة لمثبط PARP في الأنسجة التي تحمل wtp53. يوضح الشكل 4 أ ارتباطًا إيجابيًا بين p53 و PARP في عينات TNBC (انظر النقاط الحمراء). من المثير للاهتمام أن عينات سرطان الثدي ER + تظهر ارتباطًا إيجابيًا لبعض المرضى الذين تم فحصهم ، ولكن ليس جميعهم (انظر النقاط الخضراء). ترتبط المستويات العالية من p53 بـ mtp53 المستقر وهذا موجود في كثير من الأحيان في TNBC مقارنة بسرطان الثدي ER +. يمكن أن تكون الآلية الجزيئية المحتملة لتثبيت PARP و mtp53 في العينات بسبب استقرار mtp53 أثناء إجهاد النسخ المتماثل ، مما يؤدي إلى تنشيط PARP وبالتالي زيادة التوظيف. قد يكون إجهاد النسخ هو الميسر الرئيسي لتنشيط المسارات التي تؤدي إلى استقرار كل من mtp53 و PARP. ومع ذلك ، لا يزال هناك احتمال أن تغير mtp53 نسخ PARP. توضح بياناتنا مدى تعقيد الحديث المتبادل بين mtp53 R273H و PARP وتشير إلى أنه في الخلايا السرطانية ، يمكن استخدام المستويات المتزايدة من PARP و mtp53 كبديل لبقاء الخلية في وجود إجهاد النسخ المتماثل. سيكون من المثير للاهتمام تحديد ما إذا كان تالازوباريب بالاشتراك مع العامل المدمر للحمض النووي ، تيموزولوميد ، يثبط نمو العضويات في الثقافة ثلاثية الأبعاد وربما نمو طعم أجنبي (و / أو PDX) في الجسم الحي. تشير نتائجنا إلى أن اكتشاف تعايش mtp53 (الذي تم تحوره في أكثر من 80٪ من TNBC) والتعبير العالي عن PARP قد يكون علامة بيولوجية مُجمَّعة جيدة لتحديد مجموعات مرضى السرطان بدقة والتي ستستفيد من دمج PARPi talazoparib مع علاج تيموزولوميد .


نتائج

RecD2 يمنع استئناف النسخ المتماثل عن طريق الإعادة المتوقفة مؤقتًا.

Superfamily 1 هليكازات تنتقل 3′-5 على طول ssDNA (بكتريا قولونية Rep و UvrD و Bacillus stearothermophilus PcrA) تعزز حركة بكتريا قولونية يعاد من خلال مجمعات البروتين النووي ، بينما D. radiodurans RecD2 وجراثيم T4 Dda ، 5′-3 superfamily 1 هليكازات لا (10). Indeed, addition of RecD2 results in an apparent increase in the degree of replication blockage at protein–DNA complexes in vitro (10). We investigated the basis for this apparent increase in fork blockage by RecD2. We used a system in which replisomes could be blocked completely by a large array of لاك repressor–operator complexes and then the block relieved by subsequent addition of isopropyl β-D-1-thiogalactopyranoside (IPTG), allowing monitoring of the ability of blocked replisomes to resume replication (18)(Fig. 1أ and Fig. S1). Replisomes were reconstituted on plasmid templates bearing oriC and 22 tandem لاك operators. In the absence of a topoisomerase, replisomes could proceed only a limited distance along the template owing to accumulation of positive supercoiling. Continued fork movement depended on cleavage of the template by a restriction enzyme to relieve the topological strain (17) (Fig. 1أ, ثانيا و ثالثا and Fig. S1) with the site of cleavage allowing only one of the two forks to progress toward the لاك operators (Fig. 1أ, ثالثا و رابعا).

RecD2 inactivates replication forks blocked by nucleoprotein complexes in vitro. (أ) reaction scheme to monitor the ability of replisomes halted at LacI–lacO complexes to continue replication upon IPTG-induced dissociation of the barrier. (B, i) Denaturing agarose gel of replication products formed with pPM561 in the absence or the presence of 400 nM LacI with or without subsequent addition of 1 mM IPTG. Helicases added to 100 nM final concentration at step iv/v (أ) are indicated. Sizes of markers in kilobases are indicated. (ب, ثانيا) Levels of the 5.2-kb leading strand products formed in the presence of repressor after subsequent addition of IPTG relative to those obtained in the absence of repressor (see lane 1 in ب). (ج) The effects of wild-type and pinless RecD2 on the ability of forks paused at LacI–lacO complexes to continue upon addition of IPTG.

In the absence of لاك repressor, replication generated a population of lagging strands of ∼0.5 kb and leading strands of 1.3 and 5.2 kb (Fig. 1أ, السادس و ب, lane 1). In the presence of repressor, 3.5-kb, rather than 5.2-kb, leading strands were generated (Fig. 1أ, السادس و ب, lane 2 and Fig. S1), as expected if movement of replisomes was inhibited within the repressor–operator array. Subsequent addition of IPTG to these blocked forks relieved this inhibition (Fig. 1ب, lane 3), reflecting the initial retention of activity of replisomes blocked at لاك repressor–operator complexes (18).

The impact of helicases on the ability of blocked replisomes to resume replication upon addition of IPTG was analyzed. Rep, UvrD, and PcrA did not promote replication through the 22 repressor–operator complexes in the absence of IPTG (Fig. 1ب, lanes 5, 7, and 9). Addition of IPTG allowed resumption of replication even in the presence of these helicases, indicating that Rep, UvrD, and PcrA did not inhibit resumption of replication upon removal of a block (Fig. 1 ب, أنا, lanes 4, 6, and 8 and 1 ب, ثانيا). In contrast, RecD2 reduced severely the ability of replisomes to resume replication after IPTG addition (Fig. 1 ب, أنا, compare lanes 10 and 11 with lanes 3 and 2, and 1 ب, ثانيا). However, a mutant RecD2 protein, pinless RecD2, that retains DNA binding but not helicase activity (23) failed to inhibit resumption of replication (Fig. 1ج). The helicase activity of RecD2 thus inhibits continued movement of paused replisomes upon dissociation of a blocking nucleoprotein complex. T4 Dda, another superfamily 1 5′-3′ helicase, also inhibited resumption of fork movement (Fig. S2), demonstrating that fork inactivation is a general feature of this class of helicases rather than an activity associated specifically with RecD2.

RecD2 Inactivates Paused but Not Elongating Replisomes.

Inhibition of resumption of fork movement upon dissociation of the protein–DNA block could be explained by RecD2-catalyzed inactivation of paused replisomes, of elongating replisomes, or both. To distinguish between these possibilities we assessed the impact of RecD2 on the activity of elongating and of paused forks in two parallel experiments. First, the effects of wild-type and pinless RecD2 were analyzed on elongating replication forks whose movement around a supercoiled plasmid template lacking engineered barriers was sustained by DNA gyrase (Fig. 2 أ, أنا). Addition of either wild-type or pinless RecD2 alongside the replication initiator DnaA had no significant impact on levels of DNA synthesis by elongating forks (Fig. 2 أ, ثانيا). Second, replication of the same supercoiled plasmid template was initiated by DnaA in the absence of a topoisomerase as in Fig. 1, resulting in fork stalling owing to topological strain (Fig. 2 ب, أنا). Subsequent addition of a restriction enzyme relieved the strain and allowed paused forks that retained function to continue (Fig. S1). However, addition of wild-type, but not pinless, RecD2 alongside the restriction enzyme inhibited subsequent DNA synthesis (Fig. 2 ب, ثانيا). RecD2 helicase activity results, therefore, in inactivation of forks paused by positive supercoiling. Taken together, the data in Fig. 2 indicate that RecD2 inactivates paused but not elongating replisomes.

RecD2 inactivates blocked but not elongating replication forks. (A, i) Method to analyze the impact of RecD2 on elongating replication forks. (أ, ثانيا) DNA synthesis in the presence of DNA gyrase upon simultaneous addition of DnaA with or without either wild-type or pinless RecD2, each present at 100 nM final concentration. (ب, أنا) Method to monitor the impact of RecD2 on the ability of forks stalled by positive supercoiling to continue DNA synthesis upon relief of topological strain. (ب, ثانيا) Levels of DNA synthesis upon addition of a restriction enzyme with or without either wild-type or pinless RecD2 (each at 100 nM).

RecD2 Inactivates Forks Paused by a Variety of Replicative Barriers.

Different obstacles have different impacts on replisome movement. Nucleoprotein complexes and topological strain require removal of the original block for resumption of replication (Figs. 1 and 2). In contrast, DNA lesions pause forks but can eventually be bypassed. A cyclobutane pyrimidine dimer within the leading strand template pauses fork progression, but leading strand synthesis can be reinitiated downstream of the lesion over the course of several minutes (11). We tested, therefore, whether RecD2 inhibited the ability of replisomes paused at a pyrimidine dimer to bypass the lesion and continue replication.

Reactions were again initiated in the absence of a topoisomerase followed by restriction enzyme cleavage in the presence of labeled deoxynucleotide to allow forks to progress. The plasmid template contained a single pyrimidine dimer within the leading strand template (11). Following restriction enzyme cleavage for 50 s, excess unlabeled deoxynucleotide was added with or without RecD2 or pinless RecD2 and incubation continued. One minute after addition of the restriction enzyme all reactions contained predominantly stalled replication forks (Fig. 3ب, lanes 1, 5, and 9) (11). In the absence of RecD2 the majority of stalled forks generated full-length products after 8 min (Fig. 3ب, lanes 1–4). Wild-type, but not pinless, RecD2 inhibited this conversion of stalled forks into full-length products (Fig. 3ب, compare lanes 5–8 with 9–12, and 3ج). RecD2 helicase therefore prevents replisomes paused by a DNA lesion from bypassing the DNA damage.

RecD2 inactivates forks paused by template lesions. (أ) reaction scheme to monitor replication fork pausing at, and bypass of, a cyclobutane pyrimidine dimer (CPD) within the leading strand template. (ب) Native agarose gel of replication products formed on plasmid DNA harboring a pyrimidine dimer within the leading strand template. Time points were taken 1, 2, 4, and 8 min after addition of restriction enzyme and radiolabel. Positions of replication forks stalled at the pyrimidine dimer and full-length products generated by bypass of the lesion are indicated. Wild-type and pinless RecD2 were present at 100 nM, as indicated. (ج) Accumulation of full-length products as a function of time.

The data in Figs. 1–3 indicate that RecD2 helicase activity results in loss of function of paused, but not elongating, replisomes regardless of the nature of the replicative barrier.

Absence of Rep Helicase Hypersensitizes Cells to recD2 تعبير.

Inactivation of paused but not elongating replication forks by RecD2 in vitro provides a potential tool to probe fork pausing in vivo. Conversion of paused forks that retain the ability to continue replication into inactivated forks that cannot continue upon removal or bypass of blocks might present viability problems, the severity of which would depend upon the frequency and duration of fork pausing. However, induction of recD2 expression from a plasmid-based arabinose-inducible promoter had no significant impact on viability as monitored by colony-forming ability (10) (Fig. 4 أ و ب, أنا). Chromosomal DNA content of wild-type cells induced for recD2 expression was affected significantly, however, as monitored by flow cytometry under run-out conditions (Fig. 4ه, أنا). Thus, RecD2 did have an impact upon chromosome duplication. This inhibition of chromosomal duplication required RecD2 helicase activity, not just DNA binding, because recD2pinless had no impact on DNA content (Fig. 4ه, ثانيا). Sensitivity to wild-type but not pinless RecD2 in vivo correlates with inactivation of paused forks by wild-type but not pinless RecD2 in vitro (Figs. 1ج, 2ب, and 3).

التعبير عن recD2 is toxic in strains lacking Rep. (أ) Colony-forming ability of wild-type بكتريا قولونية (BW25113) and otherwise isogenic strains bearing single gene deletions upon expression of recD2 using a plasmid-based arabinose-inducible system (pMG31). Survival is represented by the number of colonies formed upon induction of recD2 expression relative to the number of colonies formed in the absence of induction. Table S2 gives strain numbers. (ب) Colony-forming ability of rep + (TB28) and Δrep (N6577) strains harboring pBADrecD2 and pBADrecD2pinless. (ج) Colony-forming ability of rep + (MG1655), rep (N4982), and repK28R (SS1076) containing pBADrecD2. (د) Colony-forming ability of rep + (MKG08) and repΔC33 (MKG10) upon recD2 overexpression (pMG31). (ه) DNA content of (i and ii) wild-type (TB28) and (iii and iv) Δrep (N6577) cells without and with induction of expression (unshaded and shaded histograms, respectively) from pBADrecD2 and pBADrecD2pinless as monitored by flow cytometry. DNA content with respect to number of chromosome equivalents per cell is indicated below. Note that Δrep cells have a higher mean number of chromosomes per cell compared with rep + (compare the uninduced samples in i and ii with iii and iv), as noted previously (39).

The ability to survive recD2 expression could be due to repair of RecD2-inactivated forks providing an efficient means of surviving such inactivation. Recombination enzymes provide multiple pathways to repair damaged replication forks (24, 25). However, no significant impact on viability was observed in the absence of any recombination gene tested, suggesting that fork processing is not critical for survival of cells expressing recD2 (Fig. 4أ ΔrecA, ΔrecB, and ΔrecF) (Table S1).

Alternatively, survival could reflect a low frequency and/or short duration of replication fork pauses in wild-type cells. Low levels of replisome pausing might be due to an inherently low frequency of pausing but might also be a consequence of multiple enzyme systems in wild-type cells that minimize fork pausing. We therefore analyzed the impact of recD2 expression in strains with a decreased ability to remove potential obstacles to replication. Lesions within the leading strand template cause replisome pausing before bypass of the lesion via repriming (11) (Fig. 3). However, absence of nucleotide excision repair did not render cells sensitive to RecD2 (Fig. 4أ, Δالأشعة فوق البنفسجية, Δالأشعة فوق البنفسجية, and ΔuvrC). Absence of Mfd, a dsDNA translocase that promotes transcription-coupled repair of DNA lesions via UvrABC (26), also did not render cells sensitive to RecD2 (Fig. 4أ). Thus, removal of bulky lesions from either nontranscribed or transcribed DNA was not required for tolerance of recD2 التعبير. Similarly, absence of one or both of the apurinic/apyrimidinic endonucleases required for base excision repair did not result in hypersensitivity to RecD2 (Fig. 4أ, ΔxthA و Δnfo). Efficient removal of DNA lesions, and thus a reduction in their potential to pause forks, was not required therefore for tolerance of recD2 التعبير.

Rep helicase provides another means to reduce fork pausing by acting at the replisome to disrupt nucleoprotein complexes ahead of the replication fork (10, 22, 27). Wild-type but not pinless RecD2 had a severe impact on colony-forming ability in the absence of Rep (Fig. 4 أ و ب). Absence of Rep also caused hypersensitivity to T4 Dda (Fig. S3أ). The toxicity of both RecD2 and Dda in Δrep cells correlated, therefore, with the ability of both helicases to inactivate replisomes in vitro. The requirement for Rep to ameliorate the impact of RecD2 on colony-forming ability was dependent on Rep helicase activity, not just DNA binding, because a rep allele bearing a mutation in the Walker A motif was sensitive to RecD2 (Fig. 4ج, ثالثا). Thus Rep does not merely block access of RecD2 to a DNA substrate. Chromosomal DNA content upon recD2 induction in Δrep cells was also reproducibly more severely affected compared with rep + cells (Figs. 4E, i و ثالثا و 5ه, أنا و F, أنا).

RecD2-directed lethality is associated with transcription complexes. (أج) Colony-forming ability of rep + and Δrep strains bearing either wild-type or mutant rpoB alleles upon no, low-, or high-level induction from pBADrecD2 (0%, 0.02% and 0.2% arabinose, respectively). Strains (i–viii) are TB28, N6577, PM486, N7604, AM2158, HB278, N7616, and HB280. (د) Colony-forming ability of rep + and Δrep strains bearing rpoB + or rpoB[H1244Q] upon induction of recD2 expression with 0.2% arabinose. Strain numbers are as in أج. (ه و F) DNA content of rep + and Δrep strains bearing rpoB + , rpoB[H1244Q], or rpoB[G1260D] without and with induction of expression of recD2 with 0.2% arabinose (unshaded and shaded histograms, respectively). The number of chromosome equivalents per cell is indicated below. Note that both rpoB[H1244Q] و rpoB[G1260D] also reduced the median number of chromosome equivalents in Δrep cells in the absence of recD2 expression from eight to four, the same number as seen in rep + cells (F، قارن أنا مع ثانيا و ثالثا). This may reflect suppression of the reduced rate of genome duplication in Δrep cells (30). Strain numbers are as in أج.

Taken together, these data indicate that inactivation of paused but otherwise functional replisomes by RecD2 results in chromosomal defects that, although exhibited by wild-type cells, are exacerbated in the absence of Rep. The corollary of these observations is that many fork pausing events do not lead to replisome inactivation under normal circumstances in either rep + or Δrep cells and that conversion of these paused forks into inactive forks by RecD2 is deleterious.

Clearance of Nucleoprotein Barriers Ahead of Forks Protects Against RecD2-Induced Cell Death.

Rep facilitates both clearance of nucleoprotein complexes ahead of forks (10, 22) and PriC-directed reloading of the replication apparatus (28, 29). However, the colony-forming ability of a strain lacking PriC was not reduced by RecD2 (Fig. 4أ) or T4 Dda (Fig. S3ب), indicating that failure of PriC-directed replisome reloading is not responsible for the inviability of Δrep cells expressing RecD2.

Efficient clearance of nucleoprotein complexes ahead of forks by Rep is dependent upon not only Rep helicase activity but also a physical interaction between the C terminus of Rep and the replicative helicase DnaB (10, 30). أ rep allele lacking the DnaB interaction domain but retaining helicase activity (repΔC33) was sensitive to RecD2 expression (Fig. 4د), consonant with efficient clearance of protein–DNA complexes ahead of forks being needed to minimize RecD2-induced viability defects. Both UvrD and DinG helicases have also been implicated in promoting replication of protein-bound DNA (10, 22), but neither helicase is known to associate physically with the replisome (31). الإفراط في التعبير عن recD2 had no impact on colony-forming ability in the absence of either UvrD or DinG (Fig. 4أ), supporting the conclusion that this toxicity is specific for the replisome-associated activity of Rep.

These data indicate that promotion of replisome movement by Rep along protein-coated DNA may be essential to avoid RecD2-directed cell death. A major source of nucleoprotein replicative barriers is transcription, with mutations within RNA polymerase subunits being able to suppress multiple defects in genome duplication (20, 32 ⇓ –34). One such mutation, rpoب[H1244Q], suppresses defects in genome duplication by reducing the stability of stalled transcription complexes (20) and inhibiting backtracking of RNA polymerase (35). We found that this mutation suppressed the RecD2-dependent killing of Δrep cells as evinced by colony-forming ability (Fig. 5 أج، قارن أنا و ثانيا مع ثالثا و رابعا, and 5د). Flow cytometry was also used to analyze DNA content. Although these analyses used rifampicin, an inhibitor of transcription initiation, to prevent replication reinitiation and simplify DNA content analysis, comparison of rpoB + with rpoB[H1244Q] revealed that rpoB[H1244Q] reduced the impact of RecD2 on chromosomal DNA content in both rep + و Δrep cells (compare أنا و ثانيا in Fig. 5 ه و F). However, suppression by rpoB[H1244Q] in Δrep cells was only partial, with both colony sizes reduced and DNA content still perturbed significantly by high level expression of recD2 (Fig. 5ج, ثالثا و رابعا، و F, ثانيا).

Other mutations in rpo genes with the ability to suppress genome duplication defects also restored colony-forming ability to Δrep cells, confirming that this suppression was not specific to rpoB[H1244Q] (Fig. 5ب, v–viii). في الواقع، rpoB[G1260D] (33) resulted in effective suppression of RecD2 toxicity even with high-level recD2 expression, as indicated by colony sizes and DNA content in Δrep cells (Fig. 5ج، قارن الخامس و السادس, and 5F، قارن أنا و ثالثا), suppression that was also apparent with dda expression in Δrep cells (Fig. S3ج). This suppression of toxicity suggested that transcription elongation factors might also provide a key means of ameliorating the consequences of paused fork inactivation. However, the simultaneous absence of four factors known to reduce RNA polymerase pausing and backtracking (26) did not render cells sensitive to recD2 expression (Fig. S4).

These data indicate that transcription complexes are the primary cause of RecD2-directed DNA content defects in both rep + and Δrep cells and of lethality in Δrep الخلايا. Together with our demonstration that RecD2 inactivates paused forks in vitro, these findings indicate that the most significant cause of paused replisomes in otherwise unperturbed cells in vivo are transcription complexes. Moreover, the primary means of resuming replication from these paused replisomes is via an accessory replicative helicase.


Origin Usage

There exist more potential initiation sites in the genome than are activated during one normal S phase. For example, specificity of origin selection varies during embryogenesis or tissue development and during a fluorodeoxyuridine block or infection by polyomavirus or SV40, as revealed by the decrease in replicon size, suggesting an increase in the number of active replication origins. Clusters of origins and their associated replicons (replication units) are activated at different times throughout S phase in a defined spatial and temporal order.

Recent comparisons of origin activity among origins of DNA replication between normal human and tumour/transformed cells revealed an approximate 2- to 3-fold difference in the activation of replication origins, including origins containing the mammalian consensus sequence (Di Paola وآخرون., 2006 ) as well as the c-myc origin and NOA3, an origin associated with the 3′ region of the ζ subunit of 14-3-3. Differential usage of origins (active and potential) may be important for the establishment and/or maintenance of different cell types, tissue-specific types and the processes of maturation or malignant transformation states. Also, a 400-bp replication enhancer within the ura4 origin region of الشوري. pombe defines the relative activities of three replication origins that are located in this region. This suggests that enhancers may influence the relative activities of individual origins found in the origin clusters of animal cells, thereby influencing origin efficiency and usage in different cell states.


خلفية

Expression of a chromosomal gene in الإشريكية القولونية can be elevated by gene amplification. The mechanism of this amplification is thought to consist of two steps, duplication and expansion. Duplication is rare, largely recA-independent, and occurs between microhomologies in the chromosome as a replication accident. Expansion is frequent, recA-dependent, and thought to result from unequal crossing-over events between the duplicated segments [1–3].

Recent investigations of gene amplification in بكتريا قولونية have focused on amplification of plasmid-borne genes. A phenotypically leaky F'-borne mutation, ϕ(lacIX13-lacZ), gives rise to Lac + revertants bearing amplified arrays of 40–80 copies of the لاك region [4]. Lac + revertants of F'لاك bearing the +1 frameshift allele ϕ(lacI33-lacZ), extensively employed in studies of adaptive mutation, consist mainly of one-base deletions in runs of iterated bases [5, 6], but clones bearing amplified arrays appear at a lower rate as well [7, 8]. Properties of لاك amplification have generally supported the duplication-expansion model. (i) An engineered duplication of the frameshift mutant لاك locus amplifies at a greatly elevated frequency [9], as predicted by the idea that duplication is the rate-limiting step (and as had been seen in the case of chromosomal ampC [2]). (ii) Amplification is dependent upon recBCD و ruvABC، إلى جانب recA, indicating an important role for homologous recombination [10].

Expansion of a pre-existing repeat has also been studied primarily on plasmids. In one study, a pBR322 derivative was constructed with two directly repeated رباعي genes, each bearing an inactivating mutation, but arranged in such a way that a single unequal crossover would generate an array of three copies, one of which was a functioning gene. In this system, expansion was reduced only five-fold in a recA mutant expansion was elevated in strains bearing mutations in dnaQ, الحمض النووي, dnaB، أو dnaN [11].

Expansion of a pre-existing duplication was compared with amplification of a single copy of F'-borne ϕ(lacI33-lacZ) in another study [10]. Expansion was found to be increased in a polA mutant, and unaffected by overexpression of xonA, while amplification from a single copy was inhibited by both of these conditions. It was concluded that the amplification defects caused by the polA mutant and by xonA overproduction were in duplication, not expansion.

This study was undertaken to characterize expansion of a repeated sequence in the bacterial chromosome. A duplication of chromosomal ϕ(lacI33-lacZ) was constructed (Fig. 1). As expected, it expands at a high rate under selection for function. The effects of mutations in various recombination, replication, DNA repair, and stress response genes on expansion of the duplication were tested. The findings support the idea that expansion occurs via homologous recombination, and suggest as well that many of the recombination events leading to expansion take place at replication forks.

Expansion of a chromosomal duplication. A. Chromosomal (lacI33-lacZ)-lacY [38] was duplicated by phage λ Red-mediated recombination with a linear DNA bearing homology-flanked antibiotic resistance marker Ab. A hypothetical mechanism by which the duplication could be generated, involving crossovers between the linear DNA and both copies of the replicating chromosomal target, is diagrammed [9]. The duplication was constructed with a tetracycline resistance element, which was later replaced with قط. Under selection for Lac function, the (lacIZ33Y)2-قط duplication expands into multiple copies. L and R – chromosomal sequences flanking لاك. E – EcoR1 restriction sites. B. Multiple copies of the repeated sequence are seen as bands produced by EcoR1 digestion of cellular DNA. Tests of two Lac + revertants, one without (-), and one with (+) an expanded لاك array, are shown as examples.


Present address: Touchstone Diabetes Center, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA

These authors contributed equally: Dae-Seok Kim, Cristel V. Camacho

الانتماءات

Laboratory of Signaling and Gene Regulation, Cecil H. and Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA

Dae-Seok Kim, Cristel V. Camacho & W. Lee Kraus

Division of Basic Research, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA


شاهد الفيديو: How to create movie bot. how to use manybot (قد 2022).


تعليقات:

  1. Zolotaur

    في رأيي ، هذه مجرد البداية. أقترح عليك محاولة البحث في Google.com

  2. Goltile

    أعتقد أنني أرتكب أخطاء. أنا قادر على إثبات ذلك. اكتب لي في PM ، وتحدث.

  3. Tatilar

    شكرا لك على المقالة

  4. Parr

    الجواب الصحيح

  5. Taumi

    لا في هذا العمل.

  6. Benkamin

    أوافق ، الشيء الجميل كثيرا



اكتب رسالة