معلومة

إحداثيات الموقع الجينومي لـ RdRp لـ SARS-CoV2

إحداثيات الموقع الجينومي لـ RdRp لـ SARS-CoV2


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أفهم أن nsp12 هو بروتين RdRp في ORF1 لجينوم SARS-CoV2. ويبدأ nsp12 من قاعدة النوكليوتيدات البادئة لـ orf1ab. هل يمكن أن تخبرني من فضلك بإحداثيات الموقع الجينومي الدقيق لـ RdRp؟

هل توجد قاعدة بيانات من حيث يمكن الحصول على تسلسل FASTA (النيوكليوتيدات و aa) لـ RdRp لـ SARS-CoV2؟

أي إجابة على هذا السؤال ستكون محل تقدير كبير.


فيما يلي طريقة قياسية ومباشرة للحصول على المعلومات المطلوبة وهي قابلة للتطبيق بشكل عام ولا تتطلب أي برمجة.

  1. انتقل إلى موقع NCBI الإلكتروني أو صفحة Genbank الخاصة به ، وحدد الجينوم من القائمة المنسدلة واكتب مصطلح البحث "SARS-CoV2" في حقل البحث:

  1. عند النقر بحث، سيتم نقلك إلى صفحة تحتوي على ملخص موجز للمعلومات حول الجينوم. في مربع ملخص الجينوم المرجعي ، انقر فوق المرجع المعرف ، NC_045512_2:

  1. يأخذك هذا إلى سجل تسلسل النوكليوتيدات لجينوم الفيروس. قم بالتمرير لأسفل (أو قم بعمل ملف تجد في متصفح الويب الخاص بك) إلى الجين المهم ، nsp12. ستجد هناك إدخالًا بإحداثيات الجينوم (13442-13468 و 13468-16236) وإشارة مرجعية للبروتين ، [YP_009725307.1 (https://www.ncbi.nlm.nih.gov/protein / 1802476815).

  1. إذا نقرت على هذا المعرف ، فسيتم نقلك إلى إدخال Genbank للبروتين المشفر بواسطة nsp12 ، مع التسلسل بتنسيق FASTA.

يمكنك تنزيل ملف يحتوي على التسلسل من ملف ارسل إلى تظهر القائمة المنسدلة. يوجد أيضًا رابط للواجهة الرسومية لعرض البروتين في سياق الجينوم (متاح أيضًا من صفحة تسلسل النيوكليوتيدات).


قاعدة بيانات مفيدة وأداة استكشافية هي UCSC Genome Browser wuhCor1مثيل متصفح التجميع.

مرادف لـ nsp12 هو Pol. نطاق موقعها فيwuhCor1التجمع هو NC_045512v2: 13،442-16،236.

هناك عدة طرق لاستخراج التسلسل ، ولكن إحدى الطرق البرمجية هي الحصول على FASTA من UCSC Goldenpath للتجميع ، واستخراج الشخصيات المهمة من نطاق الموضع للجين محل الاهتمام باستخدام أدوات Unix القياسية:

$ wget -qO- ftp://hgdownload.soe.ucsc.edu/goldenPath/wuhCor1/chromosomes/NC_045512v2.fa.gz | gunzip -c | الذيل -n + 2 | tr -d ' n' | قص -c 13442-16236 | awk '{print "> nsp12" ؛ print $ 0} '> nsp12.fa $ القط nsp12.fa> nsp12 TCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGGA CCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTC AAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAG

خيار آخر هو زيارة رابط Pol مرة أخرى والبحث عن رابط "عرض الحمض النووي لهذه الميزة (wuhCor1 / SARS-CoV-2)" ، والنقر فوقه ، والنقر فوق "الحصول على DNA" للحصول على ملف FASTA مشابه. ولكن إذا كنت ستفعل المعلوماتية الحيوية ، فإن معرفة كيفية تجميع أدوات Unix معًا هي مهارة قيمة.

للحصول على تسلسل الأحماض الأمينية ، قم بزيارة رابط Pol ، وابحث عن معلومات سجل Swiss-Prot ، وابحث من خلال UniProt عن السجل P0DTD1.

عبر إدخال "RNA-RNA polymerase" لـ P0DTD1 ، يمكنك النقر فوق منتج ما بعد الترجمة "RNA-RNA polymerase" للوصول إلى سجل به تسلسل الأحماض الأمينية: https://www.uniprot.org/ انفجار /؟ about = P0DTD1 [4393-5324] & key = Chain & id = PRO_0000449629


ترتبط طفرات RdRp بتطور جينوم SARS-CoV-2

بدأ COVID-19 ، الناجم عن فيروس SARS-CoV-2 الجديد ، في الصين في أواخر عام 2019 ، وسرعان ما أصبح وباء عالميًا. بمساعدة الآلاف من سلاسل الجينوم الفيروسي التي تراكمت ، أصبح من الممكن تتبع تطور الجينوم الفيروسي بمرور الوقت أثناء انتشاره في جميع أنحاء العالم. السؤال المهم الذي لا يزال بحاجة إلى إجابة هو ما إذا كانت أي من الطفرات الشائعة تؤثر على الخصائص الفيروسية ، وبالتالي على خصائص المرض. لذلك ، سعينا إلى فهم آثار الطفرات في بوليميريز الحمض النووي الريبي المعتمد على الحمض النووي الريبي (RdRp) ، ولا سيما طفرة 14408C و gtT الشائعة ، على معدل الطفرات وانتشار الفيروس. من خلال التركيز على الطفرات في جينات M أو E التي تتطور ببطء ، نهدف إلى تقليل آثار الضغط الانتقائي. تشير نتائجنا إلى أن طفرة 14408C و gtT تزيد من معدل الطفرات ، في حين أن طفرة RdRp الثالثة الأكثر شيوعًا ، 15324C و gtT ، لها تأثير معاكس. من المحتمل أن تكون طفرة 14408C و gtT قد ساهمت في هيمنة الطفرات المشتركة في أوروبا وأماكن أخرى.


الطفرات المحددة في RNA بوليميريز RNA المعتمد على SARS-CoV2 وهليكس يغير بنية البروتين وديناميكياته وبالتالي وظيفته: التأثير على تكاثر الحمض النووي الريبي الفيروسي

يشفر إطار القراءة المفتوح (ORF) 1ab الخاص بـ SARS-CoV2 البروتينات غير الهيكلية المشاركة في وظائف الحمض النووي الريبي الفيروسي مثل الترجمة والنسخ المتماثل بما في ذلك nsp1-4 3C مثل بروتيناز nsp6-10 RNA المعتمد على RNA بوليميريز (RdRp) هيليكاز و 3'-5 ' نوكلياز خارجي. كشفت تحليلات تسلسل ORF1ab عن ظهور طفرات خاصة في RdRp الفيروسي وهليكاز في مواقع محددة ، وكلاهما مهم في التوسط في تكاثر الحمض النووي الريبي الفيروسي. نظرًا لأن البروتينات ديناميكية بطبيعتها وتخضع وظائفها للحركات الجزيئية ، فقد أجرينا تحليلات الوضع العادي للنوع البري SARS-CoV2 و RdRp والهيليكازات المتحولة لفهم تأثير الطفرات على هيكلها وتشكلها ودينامياتها وبالتالي وظيفتها. كشفت التحليلات الهيكلية أن طفرة RdRp (في الموضع 4715 في سياق متعدد البروتين / في الموضع 323 من RdRp) تؤدي إلى تصلب الهيكل وأن الطفرة في الهليكاز (في الموضع 5828 من البروتين متعدد البروتين / الموضع 504) تؤدي إلى زعزعة الاستقرار مما يؤدي إلى زيادة مرونة بنية البروتين. قد تؤدي مثل هذه التعديلات الهيكلية وتغييرات ديناميات البروتين إلى تغيير تفكيك هياكل حلقة جذعية الحمض النووي الريبي المعقدة ، وتقارب / شغف تفاعلات الحمض النووي الريبي البوليميراز ، وبالتالي تكرار الحمض النووي الريبي الفيروسي. من شأن تحليلات الطفرات لبروتينات مركب النسخ المتماثل لـ SARS-CoV2 RNA أن تساعد في استهداف RdRp بشكل أفضل للتدخل العلاجي.


نتائج

قرب SARS-CoV-2 من الفيروسات التاجية والجينومات المضيفة ونسخة الأنسجة

منذ نهاية العام الماضي عندما ظهر لأول مرة ، كان SARS-CoV-2 يتحور وينتشر في جميع أنحاء العالم. أكثر من 5000 جينوم كامل أو شبه كامل لـ SARS-CoV-2 يمكن الوصول إليه حاليًا في GenBank ، مع طفرات مختلفة. لتحديد تسلسل SARS-CoV-2 الأكثر ملاءمة للاستخدام ، استرجعنا جميع التسلسلات المنشورة للفيروس المتوفرة في مركز بيانات SARS-CoV-2 الخاص بـ NCBI (5064 جينومات كاملة لـ SARS-CoV-2) بعد استبعاد غير مكتمل ومنخفض- متواليات الجودة وأقراص CDS مع عمليات الإدراج أو الحذف ، قمنا بحساب النسبة المئوية للفرق في استخدام الكودون بين هذه والتسلسل المرجعي. كان متوسط ​​فرق النسبة المئوية في استخدام الكودون

8 كودون / 10000 ، تظهر بوضوح أن الاختلاف في التسلسل لا يؤثر بشكل كبير على استخدام الكودون العام. تم تأكيد هذه الدرجة من الطفرة بين السلالات من خلال دراسة نُشرت مؤخرًا 29 ، وهي مشجعة لأنها تشير إلى أنه من غير المرجح أن تتطور طفرات الهروب ، حتى بالنسبة للجينات الفيروسية التي لديها أعلى ضغط اختيار مثل البروتين S. علاوة على ذلك ، قمنا بفحص بيانات التنوع الجيني من Nextstrain 30 ، والتي تمثل 4،675 جينومات SARS-CoV-2. من هذه التسلسلات ، هناك 293 موضع كودون (

23٪ من الجين S) مع إنتروبيا شانون المبلغ عنها ، أي مع وجود طفرة موثقة في هذا الموضع. من بين جميع الجينات الأخرى ، هناك 2328 موقف من هذا القبيل (

27٪ من جميع الجينات غير S) ، مما يشير إلى نسبة أعلى من الكودونات الطافرة خارج الجين S.

لوحظ وجود تناقض بين الفيروس وكودون المضيف وتحيز استخدام زوج الكودون عبر مجموعة من الفيروسات 12،13،31،32 ، لذلك قمنا بفحص ما إذا كان هذا صحيحًا بالنسبة لـ SARS-CoV-2 ومضيفه الحالي وفيروسات كورونا الأخرى. تحتوي بيانات زوج الكودون بطبيعتها على بيانات استخدام الكودون وبالتالي فهي أكثر ملاءمة من بيانات استخدام الكودون لهذا النوع من المقارنة. كما هو متوقع ، فإن استخدام زوج كودون SARS-CoV-2 يشبه عن كثب استخدام الكودون لعائلة coronoviridae ، بينما يختلف تمامًا عن استخدام زوج الكودون للجينوم البشري (الجدول 1). مضرب (تشيروبترا) والبانجولين (فوليدوتا) التي يمكن أن ينتقل منها الفيروس إلى البشر ، وكذلك إلى الكلاب (كانيس الذئبة المألوفة) التي يخشى أن ينتقل إليها الفيروس بعد ذلك ، تم تضمينها في التحليل. نجد أن هذه الأنواع لها استخدام مشابه للكودون عند مقارنتها بالإنسان ، لذلك لا يمكن استنتاج الانتفاخ الفيروسي بناءً على بيانات استخدام الكودون وحدها (الجدول 1). نظرًا لأن SARS-CoV-2 يصيب الخلايا الظهارية والخلايا الرئوية من النوع الثاني وأظهرت نتائجنا الحديثة أن استخدام زوج الكودون الخاص بالأنسجة يمكن أن يختلف اختلافًا كبيرًا عن استخدام زوج الكودون الجيني 28 ، قمنا أيضًا بفحص استخدام زوج الكودون النسخي للرئة وكيف يقارن مع استخدام زوج كودون SARS-CoV-2. بشكل مفاجئ ، كان استخدام زوج الكودون في الرئة أكثر تميزًا عن استخدام زوج كودون SARS-CoV-2 من استخدام زوج كودون SARS-CoV-2. الانسان العاقل استخدام زوج الكودون الجيني. استخدام زوج الكودون النسخي للكلى والأمعاء الدقيقة ، والأنسجة المعرضة أيضًا للعدوى ، بعيدة بالمثل عن SARS-CoV-2 (الجدول 1). في الآونة الأخيرة ، قيل أن درجة معينة من التشتت في استخدام الكودون بين الفيروس والمضيف قد يكون مفيدًا للفيروس ، لأنه لا يعيق بشدة ترجمة الجينات المضيفة 11.

استخدام الكودون وزوج الكودون والنيوكليوتيد لـ SARS-CoV-2

لفحص ميزات تسلسل SARS-CoV-2 بمزيد من التفصيل ، رسمنا استخدام الكودون الخاص به لكل حمض أميني وقارناه مع الجينوم البشري ونسخة الرئة (الشكل 1). يُظهر SARS-CoV-2 تفضيلًا واضحًا في الكودونات المنتهية بـ T و A (71.7٪) ، والتي لم يتم ملاحظتها في الجينوم البشري (44.9٪ تنتهي بـ T أو A) ونسخة الرئة (37.6٪ تنتهي بـ T أو A) . وبالمثل ، تُظهر نسخة الكلى والأمعاء الدقيقة تفضيلًا للكودونات المنتهية بـ C و G (62.5 ٪ في الكلى و 61.8 ٪ في الأمعاء الدقيقة ، الشكل التكميلي 1). تم أيضًا فحص استخدام زوج الكودون لـ SARS-CoV-2 بالتزامن مع استخدام زوج الكودون البشري (الشكل 2 أ ، ب). تم توضيح الاختلافات في استخدام زوج الكودون للجينومين في الشكل 2 ج.

ترددات Codon لكل 1000 لـ SARS-CoV-2 (أحمر) ، الانسان العاقل الجينوم (أسود) و الانسان العاقل الرئة (أصفر). يتم تجميع الكودونات حسب الأحماض الأمينية التي تقوم بتشفيرها (الأعمدة ذات اللون الأزرق الفاتح بالتناوب ، يتم تمثيل Met (M) و Trp (W) كحرف واحد).

الخرائط الحرارية لترددات أزواج الكودون المحولة من السجل لكل 1 M لـ الانسان العاقل الجينوم (أ) ، SARS-CoV-2 (ب) والقيمة المطلقة للاختلاف بين الاثنين (ج). تزداد أزواج الكودون في التردد من الظلام إلى النور.

نظرًا لأن آلية التوهين الفيروسي من خلال deoptimization زوج الكودون ليست واضحة تمامًا ، وقد قيل إنها نتيجة غير مباشرة لزيادة محتوى CpG ، فقد بحثنا أيضًا في ملف تعريف ثنائي النوكليوتيد وتقاطع ثنائي النوكليوتيد في SARS-CoV-2 أثناء مقارنته مع الانسان العاقل الجينوم ونسخة الرئة (الشكل 3). من الواضح ، أنه يتم تجنب ثنائي النوكليوتيدات CpG في جينوم SARS-CoV-2 ، وبدرجة أقل ، يتم تجنب ثنائي النوكليوتيدات CC و GG أيضًا. يوفر هذا فرصة لزيادة القدرة المناعية للقاح الفيروس الموهن المحتمل عن طريق زيادة محتوى CpG.

ثنائي النوكليوتيد (أ) ودينوكليوتيد مفرق (ب) الترددات لكل 1000 لـ SARS-CoV-2 (أحمر) ، الانسان العاقل الجينوم (أسود) و الانسان العاقل الرئة (أصفر).

طي الحمض النووي الريبي

يحدد تسلسل الجينوم ليس فقط تسلسل الأحماض الأمينية ، ولكن أيضًا بنية الحمض النووي الريبي. من المتوقع أن يكون هيكل الرنا المرسال الذي يتبع موقع تغيير الإطارات ذا صلة بيولوجيًا بشكل خاص ، حيث تم العثور على العقد الكاذبة التي تتبع الانزياح الإطار الريبوزومي المبرمج لتنظيم كفاءة انزياح الإطار 33 ، 34. لذلك سعينا إلى دراسة التشابه بين بنية SARS-CoV-2 mRNA مقارنة بهياكل مختلف الرنا المرسال لفيروس كورونا في المنطقة بعد تغيير إطار ORF1ab.

تم توقع هياكل الحمض النووي الريبي باستخدام خوارزميتين متميزتين للتنبؤ بالهيكل الثانوي ، وهما LandscapeFold 36 و NuPack 35،37. من بين أفضل 10 فيروسات فيروسات التاجية التي يتماشى الحد الأدنى المتوقع لهياكل الطاقة الحرة (MFE) بشكل أفضل مع SARS-CoV-2 ، سبعة متطابقة بين الخوارزميتين ، مما يدل على درجة عالية من الاتفاق بين مجموعتي تنبؤات الهيكل. تظهر هذه الهياكل السبعة الأفضل توافقًا في الآراء ، جنبًا إلى جنب مع هيكل ما بعد تغيير الإطار للفيروس التاجي الجديد ، في الشكل 4A-H. يمكن تفسير التشابه بين اثنين من هذه الهياكل مع SARS-CoV-2 من خلال درجة عالية من التشابه في التسلسل مع SARS-CoV-2 mRNA (فيروس كورونا متعلق بالسارس وفيروس كورونا الخفافيش ، كما هو موضح في الشكل 4 ب ، ج) . ومع ذلك ، فإن الخمسة الآخرين - وجميعهم ينتمون إلى فيروسات كورونا للطيور ، والتي هي جزء من مجموعة ما يسمى فيروسات غاماكورون ، التي تسبب أمراضًا شديدة العدوى للدجاج والديك الرومي والطيور الأخرى - لم تكن ضمن التسلسلات العشرة الأولى الأكثر ارتباطًا بالسارس. -CoV-2 mRNA على أساس التسلسل. وتجدر الإشارة إلى أنه من بين 5،064 تسلسلًا لـ SARS-CoV-2 التي تم تحليلها ، كان 3978 يحتوي على ORF1ab كاملًا مع تسلسل تغيير الإطارات "UUUAAAC" الدقيق في الموضع المشروح. من بين هؤلاء ، يشترك 3951 في نفس التسلسل في 100 nts أسفل مجرى الإشارة ، مما يشير إلى درجة عالية من الحفظ في هذه المنطقة.

(أ) الحد الأدنى المتوقع للهيكل الثانوي للطاقة الحرة (MFE) للحمض النووي الريبي لفيروس كورونا الجديد في 75 نانومتر بعد تغيير الإطار. جميع هياكل MFE المعروضة هي تلك التي تنبأت بها نتائج LandscapeFold التي تمت مناقشتها وُجد أنها غير حساسة لخوارزمية التنبؤ بالمقارنة مع NuPack. (ب,ج) فيروسات كورونا المعروفة بدرجة عالية من التسلسل والتشابه البنيوي مع فيروس كورونا الجديد. (دح) فيروسات كورونا المعروفة بدرجة عالية من التشابه الهيكلي مع فيروس كورونا الجديد ، ولكن تشابه تسلسل أقل. انظر النص الرئيسي لمزيد من المناقشة. (أنا) بالإضافة إلى فحص هياكل MFE المتوقعة ، أخذنا في الاعتبار المناظر الطبيعية الخالية من الطاقة الكاملة. يتم تخطيط احتمالية أن يشكل كل فيروس كورونا عقدة كاذبة في الـ 75 nts التي تلي تغيير الإطار (برتقالي) ، واحتمال أن يكون الجذع الأول جزءًا من عقدة كاذبة ثلاثية (أزرق).

أخيرًا ، استخدمنا LandscapeFold 36 لدراسة طي RNA خارج هياكل MFE. وجدنا أنه حتى تلك الفيروسات التاجية التي لا يحتوي هيكلها MFE على عقدة كاذبة سوف تنثني إلى عقدة كاذبة في جزء كبير نسبيًا من الحالات ، وأن معظم فيروسات كورونا لديها احتمالية عالية نسبيًا للجذع الأولي بعد طي الإطار في جزء من 3. العقدة الكاذبة الجذعية مثل تلك التي أظهرها هيكل SARS-CoV-2 MFE (الشكل 4I).

خصائص استخدام كودون الجين الفيروسي

سعينا بعد ذلك إلى فحص كل جين فيروسي بشكل منفصل من حيث استخدام الكودون وزوج الكودون. استخدام الكودون المرادف النسبي (RSCU) ودرجة زوج الكودون (CPS) هي مقاييس شائعة الاستخدام لوصف تحيز استخدام زوج الكودون والكودون ، على التوالي. تعبر RSCU عن نسبة استخدام الكودون المرادفة التي تمت ملاحظتها ، بينما CPS هي السجل الطبيعي للملاحظة عبر نسبة زوج الكودون المرادف المتوقعة باستخدام استخدام الكودون الفردي المرصود 2،38. في تحليلاتنا ، يتم اشتقاق RSCU و CPS من كودون الجينوم البشري وترددات استخدام زوج الكودون. لسهولة المقارنة ، استخدمنا ln (RSCU) لقياس تحيز استخدام الكودون. يُشار إلى متوسط ​​CPS عبر الجين باسم تحيز زوج الكودون (CPB) للجين 2. تم حساب متوسط ​​ln (RSCU) و CPB لكل جين فيروسي ومقارنته بمتوسط ​​جينات المضيف ln (RSCU) و CPB (الشكل 5). يظهر متوسط ​​RSCU و ln (RSCU) و CPB لكل جين فيروسي في الجدول 2. كان ORF10 الجين الأقل تشابهًا مع الجينوم البشري من حيث استخدام زوج الكودون والكودون ، يليه الجين E. توفر هذه الجينات فرصة ضئيلة لإلغاء التضمين ، نظرًا لأن تسلسلها بعيد عن المستوى الأمثل. من ناحية أخرى ، فإن الجينات S و N أكثر تشابهًا مع الإنسان من حيث استخدام زوج الكودون. لاستكشاف المزيد من إمكانات deoptimization زوج الكودون ، قمنا برسم CPS الخاصة بهم عبر تسلسلهم (الشكل التكميلي 2 والشكل 6). كما هو موضح في هذه الأرقام ، تستخدم جميع الجينات الفيروسية في الغالب أكواد نادرة (ln (RSCU) & lt 0) ، ومع ذلك ، فمن المدهش أن ORF6 و ORF10 يستخدمان أكواد نادرة بشكل حصري تقريبًا ، بينما ORF3a و M و ORF10 لديها بعض من أدنى ln (RSCU) القيم. فيما يتعلق باستخدام زوج الكودون ، تبرز S باعتبارها الجين الذي يستخدم أزواج الكودون المتكررة في كثير من الأحيان (قمم ذات درجات CPS عالية نسبيًا) ، بينما N و ORF6 و ORF7b هي جينات لا تستخدم أزواج كودون نادرة جدًا (قيم CPS سلبية بشكل معتدل فقط) ).

مخططات مبعثرة لانحياز RSCU [متوسط ​​ln (RSCU)] (أ) وتحيز زوج الكودون (CPB) (ب) حسب طول CDS للجينات البشرية والفيروسية. تظهر الجينات البشرية كنقاط رمادية وتظهر الجينات الفيروسية بعلامات ملونة مختلفة.

سبعة نافذة انزلاقية كودون بمتوسط ​​ln (RSCU) (أ) ودرجة زوج الكودون (CPS) (ب) من جينات SARS-CoV-2 الهيكلية. تظهر الجينات بالترتيب الذي تظهر به في الجينوم الفيروسي ، ولكن تمت إزالة الفجوات بين إطارات القراءة المفتوحة. تتناوب الجينات باللونين الأسود والأزرق من أجل الوضوح ، مع ظهور اسم الجين باللون المقابل أعلى النافذة أو أسفلها. يتم حساب RSCU و CPS على أساس الانسان العاقل استخدام الكود الجيني واستخدام زوج الكودون.


توليف الحمض النووي الريبي

تم تحضير قالب الحمض النووي الريبي ، 5′-rUrUrUrUrCrArUrArArCrUrUrArArUrCrUrCrAr- CrArUrArGrCrArCrUrG-3 و RNA التمهيدي 5′-rCrArGrUrGrCrUrArUrGrUr بالإضافة إلى ArUrrr. تم شق RNAs من الدعامة الصلبة عن طريق المعالجة بـ 4 مل من خليط 1: 1 من 28٪ بالوزن من محلول NH3 / H 2 O و 33٪ بالوزن من محلول CH3 NH 2 / EtOH عند 55 درجة مئوية لمدة 30 دقيقة ثم silyl تمت إزالة مجموعات الحماية عن طريق المعالجة بـ 3 مل من خليط 1: 1 من ثلاثي إيثيل أمين ثلاثي هيدروفلوريد وثنائي ميثيل سلفوكسيد عند 55 درجة مئوية لمدة 90 دقيقة. بعد ذلك ، تمت إضافة 30 مل من 50 ملي مولار بارد من N a C l O 4 في الأسيتون لترسيب منتج RNA. بعد الطرد المركزي ، تم إذابة بيليه الحمض النووي الريبي في 5 مل من الماء وتمريره عبر خرطوشة Sep-Pack C18 ، 5 جم مادة ماصة (مياه). تم الجمع بين الواتس المحتوية على الحمض النووي الريبي وتجفيفها بالتجميد. تم العثور على التحليل الطيفي الشامل للقالب RNA م / ض ([M- 7 H +]) = 1،341.8 (نظري 1،342.1) وموجود م / ض ([M- 6 H +]) = 1،565.6 (نظريًا 1،565.9) تم العثور على قياس الطيف الكتلي لـ RNA التمهيدي م / ض ([M- 6 H +]) = 1،278.6 (نظري 1،278.9) وموجود م / ض ([M- 5 H +]) = 1534.5 (نظري 1534.9).

التلدين من التمهيدي: قالب RNA Duplexes.

التمهيدي أحادي الخيط والقالب RNAs (الشكل 1أ) في H 2 O منزوع الأيونات ومنقى إلى تركيز نهائي قدره 200 ميكرومتر ، وخلطه بنسبة متساوية المولي ، وحضنت لمدة 5 دقائق في كتلة حرارية عند 95 درجة مئوية في أنابيب إيبندورف مع أغطية مثقوبة. تم بعد ذلك إزالة الكتلة الحرارية من جهاز التسخين وتركها لتبرد إلى درجة الحرارة المحيطة. تم بعد ذلك الاستغناء عن dsRNAs الملدنة على شكل قسامات أحادية الاستخدام ، ومجمدة فلاشية في نيتروجين سائل ، وتخزينها عند - 80 درجة مئوية.

إعادة تكوين نشاط SARS-CoV-2 RdRp وتثبيطه بواسطة favipiravir-RTP (FTP). (أ) تسلسل التمهيدي الملدن (العلوي):نموذج (أدنى) dsRNA على الوجهين المستخدم في المقايسات البيوكيميائية. (ب) يمتد SARS-CoV-2 RdRp المعاد تكوينه التمهيدي 24mer في وجود (الممرات من 4 إلى 6) ، ولكن ليس في غياب (الممرات 1 إلى 3) ، من الريبونوكليوتيدات (rNTPs). يوجد منتج 31mer في الممر 6 ، بسبب إضافة قاعدة غير مقسمة إلى حبلا التمهيدي. (ج) تم دمج Favipiravir بشكل ضعيف في حبلا التمهيدي 24mer (الممرات من 7 إلى 15) ، ويمنع تكرار الحمض النووي الريبي بواسطة SARS-CoV-2 RdRp (الممرات من 16 إلى 24). تعد فحوصات النسخ المتماثل ودمج النوكليوتيدات وتثبيط النسخ المتماثل نتائج تمثيلية لأربعة وستة وستة مكررات تقنية ، على التوالي.

تجميع مجمع apo-RdRp.

تم خلط apo-RdRp المنقى ، الذي تم تجميعه على النحو الوارد أعلاه ، على الفور بعد التنقية باستخدام dsRNA الملدن ، وتعليقه في dd H 2 O ، إلى بروتين نهائي: تركيز RNA يبلغ 8:20 ميكرومتر ، وتم تحضينه في درجة حرارة الغرفة لمدة 5 دقائق قبل الإضافة من favipiravir-RTP إلى تركيز نهائي قدره 100 ميكرومتر. بعد ذلك ، تم تحضين المجمعات لمدة 30 دقيقة إضافية في درجة حرارة الغرفة ، قبل جولة أخرى من الطرد المركزي عند 4 درجات مئوية ، ونقلها إلى أنابيب إيبندورف الطازجة ، واستخدامها على الفور لإعداد شبكات cryoEM.

التمهيدي التمهيدي ، دمج الأدوية ، ومقايسات تثبيط النسخ المتماثل.

جميع المقايسات (الشكل 1 ب و ج و الملحق SI، الشكل S1) عند درجة حرارة الغرفة في المخزن المؤقت للتجميع. تم تصميم ظروف التفاعل لتقريب ، قدر الإمكان ، تلك المستخدمة في إنتاج شبكات المجهر الإلكتروني المزجج (EM). بالنسبة لفحوصات التمديد التمهيدي ، تم تجميع 6 ميكرومتر من RdRp (تم تحضيره على النحو الوارد أعلاه) باستخدام 6 ميكرومتر من dsRNA ، وخلطها مع rATP / rGTP (بتركيز نهائي قدره 500 ميكرومتر). بالنسبة لفحوصات دمج الأدوية ، تم تجميع مجمعات RdRp: dsRNA وخلطها مع favipiravir-RTP (بتركيزات نهائية تبلغ 10 و 100 و 500 ميكرومتر) ، وتم السماح بمواصلة التفاعلات. لمقايسات تثبيط النسخ المتماثل ، تم تجميع مجمعات RdRp: dsRNA ، واحتضانها مسبقًا باستخدام favipiravir-RTP (بتركيزات نهائية تبلغ 10 و 100 و 500 ميكرومتر) لمدة 30 دقيقة ، قبل إضافة rATP / rGTP إلى تركيز نهائي من 500 ميكرومتر. هذا مشابه لبروتوكول الفحص المستخدم في remdesivir في المرجع. 10. تمت إزالة العينات في النقاط الزمنية المحددة (0 ، 30 ، و 90 دقيقة) تم إيقاف التفاعلات بإضافة 1: 1 من محلول التبريد (98٪ فورماميد ، 10 ملي مولار (إيثيلين دينتريلو) حمض تتراسيتيك) ، وميض المجمد ، و المخزنة في - 21 درجة مئوية قبل تحليل هلام.

تحليل العينة

تم تشغيل البولي أكريلاميد 20٪ ، هلام اليوريا 8 م (سمك 0.75 مم ، طول 20 سم) عند 15 وات في محلول تريس- بورات- EDTA لمدة ساعتين. تم تلوين جل RNA باستخدام SYBR Gold Nucleic Acid Gel Stain (Invitrogen). تم إجراء التصوير الفلوري باستخدام مصور Amersham Typhoon (Cytiva).

CryoEM وبناء النموذج الذري.

تم استخدام المعقد ، المحضر كما هو موضح أعلاه ، بتركيز 1.3 مجم / مل لتحضير شبكات cryoEM. تم تصنيع شبكات HexAuFoil المصنوعة من الذهب بالكامل مع مجموعة سداسية من فتحات قطرها 280 نانومتر ، وتباعد 700 نانومتر من الفتحة إلى الفتحة ، وسماكة الرقائق 330 داخل المنزل ، وتمت معالجة البلازما كما هو موصوف في المرجع. 16. تمت زراعة الجرافين عن طريق ترسيب البخار الكيميائي ، وتم نقله إلى شبكات UltrAuFoil R0.6 / 1 الذهبية بالكامل (QuantiFoil) ، وتم هدرجة جزئيًا باتباع الإجراء الموصوف سابقًا (17). تم تبريد الشبكات بسرعة باستخدام مكبس يدوي (18) في غرفة باردة 4 درجات مئوية. تم وضع حجم 3 ميكرولتر من محلول البروتين على جانب الرقاقة من الشبكة ثم تم مسحه من نفس الجانب بورق الترشيح (Whatman رقم 1) لمدة 11 ثانية إلى 14 ثانية. تم غرق الشبكات على الفور في الإيثان السائل المحفوظ عند 93 كلفن في ناظم التبريد (19) ، وتم تخزينها في النيتروجين السائل حتى تم تصويرها في المجهر الإلكتروني.

لقد حصلنا على صور مجهرية إلكترونية من أربع شبكات: ثلاث شبكات HexAuFoil (إجمالي 52881 صورة مجهرية متعددة الإطارات) وشبكة واحدة مغلفة جزئيًا بالجرافين (11،096 صورة مجهرية متعددة الإطارات) (الشكل 2).أ و الملحق SI، الجدول S1). الأسطح الأخرى التي تم فحصها أثناء التحضير الأولي للعينة تضمنت الجرافين الذي تم توظيفه باستخدام الأميلامين أو حمض الهكسانويك وأكسيد الجرافين ، ولم يحسن أي منها توزيع الاتجاه أو أسفر عن فئات ثنائية الأبعاد (2D) تشير إلى تدهور المركب بشكل أكثر شدة مما هو بسبب الهواء- واجهة المياه وحدها. وبالتالي ، لم يتم تضمينها في مجموعة البيانات لإعادة الإعمار عالية الدقة. سمحت لنا الكثافة العالية لثقوب الرقائق على شبكة HexAuFoil ، جنبًا إلى جنب مع التصوير السريع عن طريق تغيير الصورة الخالي من الانحراف وكاشف الإلكترون السريع المباشر (Falcon 4 ، 248 هرتز) ، بالحصول على أكثر من 200 صورة مجهرية في الساعة لمدة 14 متتالية أيام. يقتصر عدد الصور المجهرية التي يمكن الحصول عليها من شبكة HexAuFoil المفردة فقط على معدل تلوث الجليد في فراغ المجهر الإلكتروني ، بدلاً من عدد الفتحات الموجودة على شبكة واحدة ، حتى مع أسرع إعدادات جمع البيانات المتاحة.

الفحص المجهري الإلكتروني لمجمعات RdRp في وجود RNA و favipiravir-RTP. (أ) المجهرية الإلكترونية للمجمعات المعاد تكوينها في الجليد غير المدعوم (شبكة HexAuFoil ، العلوي) وعلى الجرافين المهدرج (أدنى) لتحديد الهيكل. (شريط مقياس ، 500 Å.) (ب) متوسط ​​هذه الفئة ثنائية الأبعاد من صور المركب ، الذي يحتوي على الحمض النووي الريبي ، يتوافق مع الاتجاه الأكثر شيوعًا للجسيمات في الطبقة الرقيقة من الماء الزجاجي. (ج) تم رسم توزيع الاتجاه ، بكفاءة ، E o d (23) ، للجسيمات المستخدمة في إعادة الإعمار على إسقاط Mollweide ، مع أكثر المناظر شيوعًا لكل نوع من الشبكات التي تم تمييزها بخطوط رمادية. (دتم رسم ارتباط قشرة فورييه (FSC) بين خريطتي نصف مقنعتين مستقلتين ، وبين الخريطة النهائية والنموذج الذري ، مقابل الدقة. (ه) نظرة عامة على خريطة EM لمركب البوليميراز ملوَّنة بوحدة فرعية: أخضر ، nsp12 أزرق ، nsp7 وردي وأرجواني ، نسختان من nsp8 أصفر ، القالب: التمهيدي RNA.

تمت معالجة جميع البيانات في RELION 3.1 (20) ، باستخدام اختيارات الجسيمات المستوردة من crYOLO 1.5 (21) (الملحق SIS2) مع إعادة التدريب اليدوي للنموذج. بعد أربع جولات من التصنيف ثنائي الأبعاد ، كان من الواضح أن العينة اعتمدت اتجاهًا مفضلًا (الشكل 2ب) ، كما ورد سابقًا (9). تم الحصول على النموذج الأولي للصقل ثلاثي الأبعاد عن طريق تصفية تمرير منخفض لخريطة منشورة للمجمع مع remdesivir (رمز الدخول إلى بنك بيانات المجهر الإلكتروني EMD-30210) (10) إلى 20 Å. تم تحسين التوحيد في توزيع اتجاه الجسيمات والتناحية لإعادة الإعمار ثلاثية الأبعاد النهائية من خلال الجمع بين البيانات من HexAuFoil وشبكات UltrAuFoil EM المطلية جزئيًا بالجرافين المهدرجة (الشكل 2).ج). بعد ثلاث جولات من التصنيف ثلاثي الأبعاد ، حصلنا على خريطة متناحرة بدقة 2.5 درجة للمجمع الكامل من 40828 جسيمًا (الشكل 2). د و ه). أنتجت مجموعة مختلفة من 140،639 جسيمًا خريطة بدقة 2.5 درجة للوحدة الفرعية nsp12 وحدها. تم التخلص من 99 ٪ المتبقية من الجسيمات ، حيث تتوافق هذه إما مع العرض المفرط للوحدة الفرعية nsp12 وحدها أو المجمعات غير المتجانسة هيكليًا التي لا تتوافق مع الدقة العالية.

تم تنقيح الانحرافات البصرية لكل شبكة ، وتم تنقيح الاستجماتيزم لكل صورة مجهرية ، وتم تنقيح إلغاء التركيز لكل جسيم. تم تتبع حركة الجسيمات أثناء التشعيع بشكل منفصل للجرافين ومجموعات البيانات HexAuFoil ، باستخدام تلميع Bayesian (22). تُظهر مجموعة البيانات الموجودة على الجرافين حركة نموذجية ناتجة عن الحزمة في بداية التشعيع ، في حين يتم التخلص من هذه الحركة عن طريق استخدام شبكات HexAuFoil ، التي وفرت جودة بيانات فائقة ، خاصة في بداية التشعيع ، عندما تكون العينة أقل ضررًا. من الجسيمات المساهمة في التحسين النهائي ثلاثي الأبعاد ، نشأ 80٪ من شبكات HexAuFoil ، و 20٪ من شبكة الجرافين المهدرجة جزئيًا. كان هذا ضروريًا لتحسين توزيع اتجاه الجسيمات: زادت الكفاءة ، E o d ، من 0.54 في الجليد غير المدعوم و 0.57 في الجرافين المهدرج جزئيًا إلى 0.68 باستخدام مزيج من الجسيمات من كلا أسطح الدعم (الشكل 2).ج) (23). تم إجراء إعادة البناء الخارجي في SIDESPLITTER (24). تم بناء النموذج الذري بناءً على نموذج ذري تم نشره سابقًا لمركب nsp12 – nsp7 – nsp8 المرتبط بـ RNA و remdesivir-RTP (بنك بيانات البروتين [PDB] رمز المعرف 7BV2) (10) ، مع بناء نموذج يدوي في Coot (25) ، 26) ، وصقل الفضاء الحقيقي في فينيكس (27).


مثبطات SARS-CoV-2 القائمة على الهيكل

حاليًا ، تم تطوير بعض المركبات ذات الجزيئات الصغيرة والتي أظهرت تأثيرات مثبطة لعدوى SARS-CoV-2 ، كما هو موضح أدناه.

ريمديسفير

Remdesivir هو نظير أدينوزين وهو مثبط قوي لـ RdRp. يمكن أن يمنع Remdesivir بشكل فعال تكاثر SARS-CoV-2 في المختبر. يُظهر Remdesivir تأثيرات مضادة للفيروسات واسعة النطاق ضد عدوى فيروس RNA في الخلايا المستنبتة ونماذج الرئيسيات غير البشرية والفئران. كنظير للأدينوزين ، يعمل ريمسفير بعد دخول الفيروس ، عبر الدمج في الحمض النووي الريبي الفيروسي الناشئ لإنهاء التكرار قبل أن ينضج الحمض النووي الريبي (Gurwitz ، 2020). Remdesivir هو نوع من الأدوية الأولية. في الخلايا المستهدفة ، سيتحول إلى شكل ثلاثي الفوسفات (RTP) ويصبح نشطًا (Siegel et & # x000a0al. ، 2017). مثل العقاقير الأولية التناظرية النوكليوتيدية الأخرى ، يمنع remdesivir نشاط RdRp من خلال الربط التساهمي مع حبلا التمهيدي لإنهاء سلسلة RNA. عند إضافة ATP ، يعرض مجمع nsp12-nsp7-nsp8 وظيفة بوليميراز الحمض النووي الريبي. ومع ذلك ، مع إضافة شكل ثلاثي الفوسفات النشط من remdesivir (RTP) ، سيتم تثبيط نشاط بلمرة RNA بشكل كبير. يتكون هيكل apo RdRp من nsp12 و nsp7 و nsp8. Besides, the template-RTP RdRp complex is composed of a 14-base RNA in the template strand as well as 11-base RNA in the primer strand. Of note, the remdesivir is in the monophosphate form (RMP) in the complex. The RMP is covalently linked to the primer strand, three magnesium ions, and a pyrophosphate. The three magnesium ions locate near the active site and promote catalysis. The RMP locates in the catalytic active site center. The catalytic active site is composed of seven motifs. There are base-stacking interactions between RMP and the base of the primer strand in the upstream. Hydrogen bonds also exists between RMP and the uridine base of the template strand. There are also interactions between RMP and side chains (K545 and R555). Twenty-nine residues from nsp12 participate the binding of the RNA directly. No residue from nsp7 or nsp8 mediates the RNA interactions (Yin etਊl., 2020).

Similar to remdesivir, favipiravir is also an inhibitor of the RdRp. The structure of favipiravir resembles the endogenous guanine. Clinical trial demonstrated that favipiravir had little side effect as the first anti-SARS-CoV-2 compound conducted in China (Furuta etਊl., 2017 Tu etਊl., 2020).

A mechanism-based inhibitor, N3, which was identified by the drug design aided by computer, could fit inside the substrate-binding pocket of the main protein and is a potent irreversible inhibitor of the main protein. Two of the Mpro-N3 complex associate to form a dimer (the two complexes are named protomer A and protomer B, respectively). Each protomer contains three domains which are designated as domain I−III. Both domain I and domain II have a β-barrel structure arranged in antiparallel manner. Domain III has five α-helices which associate to form a globular cluster structure in antiparallel manner. Domain III connects to domain II with a long loop. The cleft between domain I and domain II contains the substrate binding site. The backbone atoms of the compound N3 form an antiparallel sheet with residues 189� of the loop that connects domain II and domain III on one side, and with residues 164� of the long strand (residues 155�) on the other (Jin et al., 2020a) ( الشكل 5 أ ).

The crystal structure of N3 and its inhibitors. (أ) The crystal structure of N3-main protease complex. The main protease is colored brightorange. N3 is colored green (PDB: 6LU7). (ب) The crystal structure of 11a-main protease complex. The main protease is colored brightorange, 11a is blue (PDB: 6LZE). (ج) The crystal structure of 11b-main protease complex. The main protease is brightorange, 11b is red (PDB: 6M0K). (د) The crystal structure of Carmofur-main protease complex. The main protease is brightorange, carmofur is cyan (PDB: 7BUY).

11a and 11b

Two compounds, namely 11a and 11b which target the M pro , exhibit excellent inhibitory effects on SARS-CoV-2 infection في المختبر. The inhibitory activity of 11a and 11b at 1 µM is 100 and 96%. In vivo, the 11a and 11b exhibit good pharmacokinetics (PK) properties. Of note, 11a showed low toxicity as well. The -CHO group of 11a and 11b bond to the cysteine 145 of M pro covalently. Different parts of 11a (designated as P1’, P1, P2, and P3) fits into different parts of the substrate-binding site. The (S)-γ-lactam ring of 11a at P1 inserts into the S1 site. The cyclohexyl moiety of 11a at P2 fits into the S2 site. At the part P3 of 11a, the indole group is exposed to the S4 site (in the solvent). The oxygen atom of -CHO forms a hydrogen bond with the cysteine 145 in the S1’ site. In addition, many water molecules (designated as W1−W6) are critical for binding 11a. The SARS-CoV-2 M pro -11b complex is similar to the SARS-CoV-2 M pro -11a complex and the 11a and 11b exhibit similar inhibitor binding mode (Dai W. et al., 2020) ( Figures 5B, C ).

Camostat Mesylate

TMPRSS2 and TMPRSS4 are two mucosa-specific serine proteases which facilitate the fusogenic activity of SARS-CoV-2 spike protein and facilitate the virus to enter host cells (Zang etਊl., 2020). SARS-CoV-2 employs the TMPRSS2 in cells to prime the spike protein. TMPRSS2 activity is critical for the spread of SARS-CoV-2 as well as the pathogenesis in the infected host. Therefore, TMPRSS2 is a potential antiviral target. The spectrum of cell lines mediated entry by the S protein of SARS-CoV-2 and SARS-CoV are similar. Camostat mesylate, a clinical TMPRSS2 inhibitor, can partially block SARS-CoV-2 spike-driven entry into lung cells. In addition, camostat mesylate exhibits potent inhibit activity on SARS-CoV, SARS-CoV-2, and MERS-CoV, inhibiting them from entering lung cell line Calu-3, without cytotoxicity. In conclusion, camostat mesylate has the potential to treat and prevent COVID-19 (Hoffmann etਊl., 2020).

Carmofur

The antineoplastic drug carmofur can inhibit the main protease (M pro ) of SARS-CoV-2. The crystal structure of carmofur-main protease complex has been solved. Carmofur inhibits the activity of SARS-CoV-2 main protein في المختبر and the half-maximum inhibitory concentration (IC50) is 1.82 μM. Carmofur is an approved antineoplastic agent used for colorectal cancer. It is a derivative of 5-fluoroyracil (5-FU). The molecular details of how carmofur inhibits the activity of SARS-CoV-2 main protein have not been resolved. One study showed the crystal structure of SARS-CoV-2 M pro -carmofur complex. The electron density figure indicates that the fatty acid moiety (C7ح14NO) of carmofur links with the Sγ atom of SARS-CoV-2 main protein catalytic residue Cys145 covalently. The electrophilic carbonyl group of carmofur is attacked by the sulfhydryl group of Cys145. This process modifies the Cys145 covalently and releases the 5-FU motif. Notably, numerous hydrogen bonds and hydrophobic interactions stabilize the inhibitor carmofur. The fatty acid tail of carmofur (an extended conformation) inserts into the S2 subunit of SARS-CoV-2. Most of the hydrophobic interactions are contributed by His41, Met165, and Met49 in the side chain (Jin et al., 2020b) ( Figure 5D ).

Lipopeptide EK1C4

The complex (6-HB) formed by the HR1 and HR2 of the SARS-CoV-2 S protein could facilitate the infection of the viruses (Xia et al., 2020b). EK1 is one kind of coronavirus fusion inhibitor and has an inhibitory effect on various coronaviruses. It targets the HR1 of the S protein of human coronavirus and has been proved to effectively inhibit the infection of five HCoVs, including SARS-CoV and MERS-CoV. Peptide EK1 could intervene the formation of viral 6-HB (Xia et al., 2020a). A recent study shows that the peptide EK1 could also inhibit the membrane fusion mediated by SARS-CoV-2 spike protein as well as SARS-CoV-2 pseudovirus infection in a dose-dependent manner (Xia et al., 2020a Xia et al., 2020b). EK1C is constructed by covalently attaching the cholesterol acid to the C-terminal of EK1 sequence. It is noteworthy that the lipopeptide EK1C4 has the strongest inhibitory effect on the membrane fusion which is mediated by the spike protein, with IC50 of 4.3 nM. However, the IC50 of EK1 is 409.3 nM. EK1C4 could also potently inhibit the infection caused by live coronavirus في المختبر with little, or even no, toxic effect. In conclusion, EK1C4 has the potential to be used for the treatment and prevention of COVID-19 (Xia et al., 2020a).


توافر البيانات

The PhyloCSF tracks and FRESCo synonymous constraint elements are available for the SARS-CoV-2/wuhCor1 assembly in the UCSC Genome Browser at http://genome.ucsc.edu as public track hubs 1,37,38,42 named “PhyloCSF” and “Synonymous Constraint”. All other data generated or analysed during this study are included in this published article and its supplementary information files. This study made use of publicly available datasets from GISAID (https://www.gisaid.org) and from UniProtKB/Swiss-Prot (https://www.uniprot.org). Source data are provided with this paper.


مقدمة

The SARS-CoV-2 (a member of Coronaviruses) outbreak occurred in Wuhan, China in December 2019, and it became a pandemic by spreading to almost all countries worldwide. The SARS-CoV-2 causes the COVID-19 disease that has created a global public health problem. As of May 8, 2020, more than 3.9 million confirmed COVID-19 cases were reported worldwide with 0.27 million confirmed deaths. As the virus spreads to new locations, it alters its protein sequence by the introduction of mutations in its genome that help it to survive better in the host (Sackman et al., 2017). The β lymphocytes of the host adaptive immune system eventually identify the specific epitopes of the pathogenic antigen and start producing protective antibodies, which in turn results in agglutination and clearance of the pathogen (Alcami & Koszinowski, 2000 Chaplin, 2010 Jensen & Thomsen, 2012). Being an efficient unique pathogen, a virus often mutates its proteins in a manner that it can still infect the host cells, evading the host immune system. Even when fruitful strategies are discovered and engaged, the high rate of genetic change displayed by viruses frequently leads to drug resistance or vaccine escape (McKeegan, Borges-Walmsley & Walmsley, 2002).

The SARS-CoV-2 has a single stranded RNA genome of approximately 29.8 Kb in length and accommodates 14 ORFs encoding 29 proteins that include four structural proteins: Envelope (E), Membrane (M), Nucleocapsid (N) and Spike (S) protein, 16 non-structural proteins (nsp) and nine accessory proteins (Gordon et al., 2020a Wu et al., 2020) including the RNA dependent RNA polymerase (RdRp) (also named as nsp12). RdRp is comprised of multiple distinct domains that catalyse RNA-template dependent synthesis of phosphodiester bonds between ribonucleotides. The SARS-CoV-2 RdRp is the prime constituent of the replication/transcription machinery. The structure of the SARS-CoV-2 RdRp has recently been solved (Gao et al., 2020) and show three distinct domains.

For RNA viruses, the RdRp presents an ideal target because of its vital role in RNA synthesis and absence of host homolog. RdRp is therefore a primary target for antiviral inhibitors such as Remdesivir (Gordon et al., 2020b) that is being considered a potential drug for the treatment of COVID-19. Since RNA viruses constantly evolve owing to the rapid rate of mutations in their genome, we decided to analyse the RdRp protein sequence of SARS-CoV-2 from different geographical regions to see if RdRp also mutates. Here, in the present study, we identified and characterised three mutations in the RdRp protein isolated from India against that of the ‘Wuhan wet sea food market’ (Wu et al., 2020) SARS-CoV-2. Altogether, our data strongly suggest at the prevalence of mutations in the genome of SARS-CoV-2 needs to be considered to develop new approaches for targeting this virus.


SARS-CoV-2 Standard #COV019

При работе с нашим интерактивным средством для поиска сертификатов анализа придерживайтесь следующих рекомендаций:

  • Убедитесь, что Вы ввели правильный номер по каталогу и номер партии (или контрольный номер) в полях для поиска.
  • Если Вы используете набор, попробуйте поискать сертификат анализа по данным набора, а также по данным индивидуальных компонентов.
  • Необходимый сертификат анализа может быть недоступен на веб-сайте. В этом случае можно обратиться к представителю Bio-Rad или воспользоваться формой запроса.

Если не удается найти требуемый сертификат анализа, воспользуйтесь формой запроса по приведенной ссылке.

Где можно найти номер по каталогу, номер артикула или продукта?

Номер по каталогу, номер артикула или продукта напечатаны на этикетке продукта. Местоположение этой информации показано на приведенном ниже образце.

Где можно найти номер партии или контрольный номер?

Номер партии или контрольный номер (только один из двух) напечатан на этикетке продукта. Местоположение этой информации показано на приведенном ниже образце.

Почему сертификаты анализа находятся не на вкладке документов?

Сертификаты анализа связаны не только с продуктом, но и с конкретными партиями этого продукта. Для каждого продукта может быть доступно несколько сертификатов анализа, особенно если данная линия продуктов выпускается давно и за годы производства было выпущено несколько партий. С помощью средства поиска сертификатов анализа можно ввести номер по каталогу и номер партии (или контрольный номер) для конкретного продукта, находящегося у Вас на руках, и загрузить необходимый сертификат анализа.

У меня есть номер серии, а не номер партии или контрольный номер. Как мне найти сертификат анализа для моего продукта?

Номер серии можно использовать вместо номера партии или контрольного номера. Используйте средство поиска сертификатов анализа: введите номер по каталогу, как обычно, а вместо номера партии или контрольного номера укажите номер серии.

Могу ли я получить сертификат анализа, если срок действия моего продукта истек?

Да. Несмотря на то, что мы периодически удаляем сертификаты анализа в ходе процедур обслуживания сайта, мы стараемся оставлять их в доступе в течение продолжительного времени после истечения срока действия продукта.

Почему для сертификата анализа, приведенного в результатах поиска, имеется пометка «Название продукта не найдено»?

Существуют сертификаты анализа для продуктов, выпуск которых прекращен, или продуктов, которые недоступны на веб-сайте. В таких ситуациях сертификат анализа доступен для загрузки, однако другие сведения о продукте, такие как его название, недоступны.

Почему для сертификата анализа, приведенного в результатах поиска, имеется пометка «Недоступно»?

Это означает, что Вы ввели правильный номер по каталогу и номер партии (или контрольный номер), и мы нашли сертификат анализа. Однако по какой-то причине сам файл недоступен.

Воспользуйтесь формой запроса или обратитесь к представителю Bio-Rad, чтобы мы выслали Вам сертификат анализа.


Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases

How to cite: Kim, S. Kim, D. Lee, B. Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases. المطبوعات المسبقة 2020, 2020020424 (doi: 10.20944/preprints202002.0424.v1). Kim, S. Kim, D. Lee, B. Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases. Preprints 2020, 2020020424 (doi: 10.20944/preprints202002.0424.v1). ينسخ

استشهد على النحو التالي:

Kim, S. Kim, D. Lee, B. Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases. المطبوعات المسبقة 2020, 2020020424 (doi: 10.20944/preprints202002.0424.v1). Kim, S. Kim, D. Lee, B. Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases. Preprints 2020, 2020020424 (doi: 10.20944/preprints202002.0424.v1). ينسخ


شاهد الفيديو: SARS-CoV-2 Real-TM. SACACE (قد 2022).