معلومة

كيف يمكن لتسلسل SD / Kozak الجيد أن يعزز كفاءة الترجمة؟

كيف يمكن لتسلسل SD / Kozak الجيد أن يعزز كفاءة الترجمة؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

في بدائيات النوى ، إذا كان هناك مرنا جيد (تقريبا تسلسل الإجماع) تسلسل Shine-Dalgarno (SD) ، سوف ترتبط بروتينات الريبوسوم به.

في حقيقيات النوى ، يرتبط الريبوسوم بغطاء 5 بوصات ، ثم يبدأ في الانزلاق حتى يجد تسلسل كوزاك الجيد ويبدأ الترجمة.

  1. لماذا سيعزز التسلسل الجيد (SD & Kozak) كفاءة الترجمة بشكل كبير في كلتا الحالتين؟ لا أستطيع أن أفهم هذا لأن الترجمة تدور حول القواعد النهائية لتلك التسلسلات ، وليس لدي أي فكرة عن كيفية تأثيرها على الكفاءة الكلية.

  2. في حقيقيات النوى ، كيف يمكن "توقع" الريبوسوم وهو أفضل كوزاك في الحمض النووي الريبي؟ على سبيل المثال هناك 2 'AUG' في ذلك الرنا المرسال وأول واحد لديه توافق أفضل على Kozak. فكيف يمكن للريبوسوم "معرفة" أن الكوزاك الثاني أسوأ من الأول ، ويبدأ الترجمة في البداية "AUG" ، لكن لا يستمر في الانزلاق نحو الكوزاك الثاني؟

شكرا


أوصي بشدة بالبحث بمزيد من التفصيل في الموارد المتاحة لتسلسل SD و Kozak ، تجيب ويكيبيديا أساسًا على هذه الأسئلة ولديها الكثير من القراءة إذا كنت ترغب في استكشاف هذه الأسئلة.

في الوقت نفسه ، تذكر أن هذه عمليات إحصائية تتضمن آلاف الجزيئات ، وليست عمليات حتمية تحدث في جزيء واحد. وبالتالي ، فإن ما يتغير مع التسلسلات المختلفة هو معدل حدوث خطوة ما (مثل معدل تجميع الريبوسوم ، ومعدل بدء الترجمة ، ومعدل التعرف على البداية) ؛ لن تحدث أي من هذه الخطوات مع احتمال 100٪ على كل جزيء mRNA.

ما يعنيه هذا هو أنه يمكنك كتابة معادلات للنماذج الحركية للترجمة ، مما يسمح لنا بتطبيق مبادئ الفعل الجماعي ومعدلات التفاعل من الكيمياء الأولية. وبالتالي ، فإن وجود معدل أعلى من تقارب الريبوسوم للتسلسل يشبه في الواقع وجود المزيد من الرنا المرسال ، بمعنى أنك في كلتا الحالتين سوف تقوم بترجمة أكثر وتنتج المزيد من البروتين.

وبالتالي ، قد يكون من الأسهل استخدام مصطلحات متواليات SD / Kozak "القوية" و "الضعيفة". يحتوي التسلسل القوي على معدل تفاعل مرتفع ويكون للتسلسل الضعيف معدل رد فعل منخفض. هنا ، "رد الفعل" المعني هو ربط الريبوسوم ، أو بدء الترجمة ، أو أي عملية ندرسها حاليًا.

الآن ، فيما يتعلق بالأسئلة المحددة:

  1. تسلسل يغير معدل حدوث عمليات المصب. لذلك ، على سبيل المثال غالبًا لن يؤدي تسلسل كوزاك الضعيف ببساطة إلى بدء الترجمة ، وسيسقط الريبوسوم دون ترجمة أي شيء. لن يحدث هذا تقريبًا مع تسلسل Kozak القوي ، لذا فإن Kozak القوي يكون "أكثر كفاءة" بمعنى أنه يؤدي إلى الترجمة بشكل أكثر موثوقية. يزيد تسلسل Shine-Dalgarno القوي من معدل حدوث ارتباط الريبوسوم.

يعد كل من ربط الريبوسوم وبدء الترجمة ضروريين لإنتاج البروتين ، لذلك إذا قمت بزيادة معدل حدوث هذه العمليات ، فإنك تزيد من كفاءة الترجمة في كل حالة.

  1. لا يوجد "استشراف". فكر في هذا ميكانيكيا. يقوم الريبوسوم بمسح 3 'على طول mRNA ، بدءًا من نقطة التعلق. أيضًا ، يمكن لكل مرفق ريبوسوم في mRNA بدء حدث ترجمة واحد فقط. بمجرد أن يتوقف الريبوسوم عن المسح ويبدأ في الترجمة ، فإنه لا يتعرف على Kozaks اللاحقة.

وبالتالي ، إذا كان هناك تسلسل Kozak قوي ، فستبدأ الترجمة دائمًا تقريبًا في التسلسل القوي ، ولن تتاح لها الفرصة أبدًا للبدء بتسلسل آخر 3 '. في الغالب فقط عندما يكون Kozak 5 ضعيفًا ، يتم التعرف على المزيد من Kozak على الإطلاق ("المسح المتسرب"):

لا يتم التعرف دائمًا على كود البدء الأول الأقرب إلى الطرف 5 'من الشريط إذا لم يكن موجودًا في تسلسل يشبه Kozak. Lmx1b هو مثال على جين ذو تسلسل إجماع كوزاك ضعيف. لبدء الترجمة من هذا الموقع ، يلزم وجود ميزات أخرى في تسلسل mRNA حتى يتعرف الريبوسوم على كودون البدء. قد تحدث استثناءات لقاعدة AUG الأولى إذا لم يتم تضمينها في تسلسل يشبه Kozak. وهذا ما يسمى بالمسح المتسرب ويمكن أن يكون طريقة محتملة للتحكم في الترجمة من خلال البدء. لبدء الترجمة من هذا الموقع ، يلزم وجود ميزات أخرى في تسلسل mRNA حتى يتعرف الريبوسوم على كودون البدء. (ويكيبيديا)

لذلك ليس بالضرورة أن Kozaks مطلوبة. تحتاج فقط إلى مجموعة من الظروف التي تزيد من احتمال أن يبدأ الريبوسوم في الترجمة بجوار كودون البداية. يحدث أن يكون Kozak ببساطة وسيلة فعالة للحصول على الريبوسوم لبدء الترجمة. كلما اقترب التسلسل من تسلسل كوزاك الإجماعي ، كلما كان أكثر فاعلية ، لأن احتمال بدء الترجمة أعلى.


تسلسل كوزاك يجب أن يكون في الإطار؟ - (يونيو / 07/2007)

مرحبًا بالجميع ، لقد واجهت بعض المشكلات مع بنية واحدة كنت أقوم بها ، أحاول استنساخ عامل نسخ واحد إلى ناقل حقيقي النواة (pEYFPN1) ، بعد بعض العمل ، لديّ بنائي ، لذلك قمت بنقله إلى 293 خلية تائية ، ووجدت أن نمط التوزيع لهذا البناء لا يبدو كما ينبغي ، يبدو أن هذا هو البروتين الفلوري وحده (YFP) ، لذلك أشعر بالقلق وألقي نظرة مرة أخرى على البادئات التي استخدمتها لتضخيم عامل التراكب هذا ، ووجدت أن تسلسل Kozak الذي أعطاني إياه PI على التمهيدي ليس في إطار مع كود بدء ATG ، هل هذه مشكلة ، أو أن تسلسل Kozak لا يؤثر على كود بدء ATG. هذا هو التمهيدي الذي استخدمته ، ويحتوي على موقع Bgl II:

5 "GCATCCAGATCTCGCCACCATGCCAAGCACCAGCTTT 3"

تسلسل الإجماع لتسلسل كوزاك على النحو التالي
(دول مجلس التعاون الخليجي) دول مجلس التعاون الخليجي (A / G) ccAUGG

التمهيدي
5 "GCATCC AGATCT ج مجلس التعاون الخليجيأنسخةATG CCAAGCACCAGCTTT 3 '

معظم تسلسل كوزاك موجود. يعمل الريبوسوم عن طريق المسح على طول نسخة mRNA بحثًا عن مواقع ATG جيدة لربطها. لذلك ليس هناك مسألة في الإطار أم لا ، بل هل التسلسل جيد بما يكفي لإيقاف مركب الريبوسوم مؤقتًا بحيث يبدأ الترجمة.

أود أن أقول إن kozak sequnece بخير. على الرغم من أن هذا لا يستبعد مشاكل التعبير ، على سبيل المثال ، قد يتصرف المروج. أو أن منتج الجين نفسه يسبب مشاكل.

ماذا يحدث إذا تخلصت من تسلسل الكوزاك.

تسلسل الإجماع لتسلسل Kozak على النحو التالي
(دول مجلس التعاون الخليجي) دول مجلس التعاون الخليجي (A / G) ccAUGG

التمهيدي
5 "GCATCC AGATCT ج مجلس التعاون الخليجيأنسخةATG CCAAGCACCAGCTTT 3 '

معظم تسلسل كوزاك موجود. يعمل الريبوسوم عن طريق المسح على طول نسخة mRNA بحثًا عن مواقع ATG جيدة لربطها. لذلك ليس هناك مسألة في الإطار أم لا ، بل هل التسلسل جيد بما يكفي لإيقاف مركب الريبوسوم مؤقتًا بحيث يبدأ الترجمة.

أود أن أقول إن kozak sequnece بخير. على الرغم من أن ذلك لا يستبعد مشاكل التعبير ، على سبيل المثال ، قد يتصرف المروج. أو أن منتج الجين نفسه يسبب مشاكل.

بدون تسلسل kozak ، ستنخفض كفاءة ترجمة البروتين. كيف سيئة ليس لدي فكرة. المروج هو عامل هنا. أي إذا كان لديك الكثير من mRNA ، فقد يعوضك عن تقليل كمية الترجمة.

ما هي المشكلة في الواقع. هل يمكن أن تشرح أكثر من ذلك بقليل. هو YFP لا يعبر؟ أم أنها ذاهبة إلى المكان الخطأ؟ هل لديك سنغال التعريب الصحيح الموسومة على YFP.

هل تعبر عن YFP فقط أم أنها بناء اندماج؟

يبدو تسلسل Kozak في التمهيدي جيدًا باستثناء وجود G بعد ATG. لا ينبغي أن يهم كثيرا.

وجود كوزاك يزيد بشكل كبير من إمكانية التعبير اللائق.

يمكن قراءة تأثير السياق المختلف في تسلسل كوزاك في هذه الورقة.

بحوث الأحماض النووية ، 2004 ، المجلد. 32 ، رقم 4
5´ مناطق غير مترجمة مع عدة AUG المنبع
يمكن أن تدعم الكودونات الترجمة منخفضة المستوى عبر التسريب
المسح وإعادة التهيئة
Xue-Qing Wang و Joseph A. Rothnagel *

A من ATG هو +1
هذا مقتطف من الورق

& quot قوة تسلسلات سياق AUG تتراوح
من & # 96strong & # 39 إلى & # 96weak & # 39 وبترتيب تنازلي A-3 + G + 4
& gt G-3 + G + 4 & gt A-3 + A + 4 & gt G-3 + A + 4 & gt U-3 + G + 4 & GT U-3 + A + 4 & quot

أنا آسف لأنني لا أستطيع تحميل هذه الورقة

هل تعبر عن YFP فقط أم أنها بناء اندماج؟

يبدو تسلسل Kozak في التمهيدي جيدًا باستثناء وجود G بعد ATG. لا ينبغي أن يهم كثيرا.

وجود كوزاك يزيد بشكل كبير من إمكانية التعبير اللائق.

البناء عبارة عن اندماج بين YFP وعامل النسخ الخاص بي ، وعندما أقوم بترنسفكأيشن في 293 خلية تي ، رأيت انخفاضًا شديدًا & # 33 & # 33 & # 33 & # 33 & # 33 & # 33 & # 33 & # 33 & # 33 expresion ، في طبق واحد من 35 مم يمكنني فقط العثور على 4-5 خلايا ذات مضان (سيطرتي التي هي فقط YFP لديها 90 ٪ من كفاءة تعداء) ، وهي ضعيفة جدًا ، يجب أن يكون عامل النسخ هذا (Nfatc1) على سيتوبلازم الخلايا وبعد زيادة Ca2 + يجب أن تنتقل إلى النواة ، لكن الشيء الوحيد الذي يمكنني رؤيته هو التألق في جميع أنحاء الخلية (مضان ضعيف) واعتقدت أن التمهيدي thas يحتوي على تسلسل kozak وعلى الفور لا يكون ATG في الإطار. لكنك قلت أن البرايمر يبدو جيدًا ، لذا لا أعرف.

هل تعبر عن YFP فقط أم أنها بناء اندماج؟

يبدو تسلسل Kozak في التمهيدي جيدًا باستثناء وجود G بعد ATG. لا ينبغي أن يهم كثيرا.

وجود كوزاك يزيد بشكل كبير من إمكانية التعبير اللائق.

شكرا لك على الورقة ، سوف أقرأها

يمكن قراءة تأثير السياق المختلف في تسلسل كوزاك في هذه الورقة.

بحوث الأحماض النووية ، 2004 ، المجلد. 32 ، رقم 4
5´ مناطق غير مترجمة مع عدة AUG المنبع
يمكن أن تدعم الكودونات الترجمة منخفضة المستوى عبر التسريب
المسح وإعادة التهيئة
Xue-Qing Wang و Joseph A. Rothnagel *

A من ATG هو +1
هذا مقتطف من الورق

& quot قوة تسلسلات سياق AUG
من & # 96strong & # 39 إلى & # 96weak & # 39 وبترتيب تنازلي A-3 + G + 4
& gt G-3 + G + 4 & gt A-3 + A + 4 & gt G-3 + A + 4 & gt U-3 + G + 4 & GT U-3 + A + 4 & quot

أنا آسف لأنني لا أستطيع تحميل هذه الورقة

هل تعبر عن YFP فقط أم أنها بناء اندماج؟

يبدو تسلسل Kozak في التمهيدي جيدًا باستثناء وجود G بعد ATG. لا ينبغي أن يهم كثيرا.

وجود كوزاك يزيد بشكل كبير من إمكانية التعبير اللائق.

لكن السؤال هو ، & quot؛ هل كلا الجزأين من جين الاندماج في الإطار؟ & quot
أو ربما تسبب الاندماج مع YFP في حدوث مشكلات في طي عامل النسخ ، هل جربت اندماج طرفي N و C على حد سواء؟ أحيانًا يساعد تسلسل رابط طويل .. تسلسل فاصل حلقي عشوائي بين البروتينين.
هل تعرف أي أجزاء من عامل النسخ الخاص بك هي نهاية العمل؟

المصطلح C لعامل النسخ الخاص بي في إطار مع ATG الخاص بـ YFP.


من أين أبدا؟ آلية ترجمة البروتين البديلة تخلق مستضدات غير متوقعة

بروح الصحة الجيدة ، تخضع الخلايا باستمرار لمحتوياتها من البروتين للمراقبة المناعية بواسطة الخلايا التائية السامة للخلايا (القاتلة). عشرات الآلاف من جزيئات الفئة الأولى من معقد التوافق النسيجي الرئيسي (MHC) من جزيئات مهد الببتيدات (أجزاء من البروتينات) على أسطح الخلايا ، وتكتشف الخلايا التائية أي ببتيدات مشبوهة ذات حساسية شديدة. إذا أصيبت خلية بفيروس ، فإن الببتيدات التي تم إنشاؤها من الحمض النووي الفيروسي سينتهي بها المطاف على سطح الخلية كمستضدات ، مما يؤدي إلى ظهور علامات حمراء مناعية.

يتم إنشاء معظم & # x02014 ولكن ليس كل & # x02014 من الببتيدات التي تقدمها جزيئات MHC من الفئة الأولى بواسطة آليات خلوية تقليدية: بمساعدة الريبوسوم ، يتم فك تشفير ثلاثة نيوكليوتيدات mRNA (كودون) إلى حمض أميني مطابق ، والذي يتم تثبيته كالتالي الارتباط على استطالة الببتيد. تبدأ معظم الببتيدات بالحمض الأميني ميثيونين ، المشفر بواسطة النوكليوتيدات الثلاثية الرنا المرسال A-U-G (AUG). لكن بعض الببتيدات & # x0201ccryptic ، & # x0201d تنشأ من مناطق mRNA غير المترجمة عادةً أو بدأت باستخدام أكواد أخرى غير AUG.

اقترحت الدراسات السابقة أن آلية الترجمة غير التقليدية تخلق بعض الببتيدات المشفرة. ولكن كيف؟ و لماذا؟ يُعرف نوع واحد فقط من بادئ الترجمة ، نقل الحمض النووي الريبي (الحمض النووي الريبي) الخاص بـ AUG والمحمّل بجزيء ميثيونين. يُعزى تخليق البروتين الذي يبدأ عند الكودونات البديلة إلى الاقتران غير الدقيق بين بادئ ترجمة الميثيونين و mRNA. ومع ذلك ، فإن هذا لا يفسر تأثير البروتينات ليس ابدأ بالميثيونين.

تم اكتشاف آليتين فقط لبناء الببتيدات غير الميثيونين. في دراسة جديدة ، سوزان ر. شواب وآخرون. تميز واحدًا منهم ، الترجمة التي بدأتها CUG للببتيد بدءًا من ليسين بدلاً من الميثيونين.

استكشف المؤلفون الترجمة الخلوية عن طريق هندسة الخلايا لإنشاء الببتيدات ذات الأهمية وتقديمها من خلال مطابقة جزيئات معقد التوافق النسيجي الكبير على أسطح الخلايا. بعد ذلك ، من خلال تسخير الحساسية الرائعة للخلايا التائية لاستكشاف المستضدات على جزيئات معقد التوافق النسيجي الكبير ، تمكنوا من تحديد الببتيدات التي تم إنشاؤها في ظل ظروف تجريبية مختلفة.

تشير النتائج التي توصلوا إليها إلى آلية ترجمة فريدة. في المثال الآخر المعروف للببتيد غير الميثيونين ، فإن الترجمة التي تبدأ في GCU أو CAA تسترشد ببنية مطوية محددة من نيوكليوتيدات الرنا المرسال تسمى موقع دخول الريبوسوم الداخلي. شواب وآخرون. وجدت أنه لا توجد بنية مماثلة ضرورية للترجمة التي تبدأ CUG. ومع ذلك ، على غرار الآلية القياسية لبدء AUG ، وجدوا أن الريبوسومات تقوم بمسح CUG. بالإضافة إلى ذلك ، فإن وجود تسلسل محدد لربط الريبوسوم في mRNA (سياق & # x0201cKozak & # x0201d) بالقرب من موقع CUG يمكن أن يعزز كفاءة البدء هناك.

شواب وآخرون. اقترحوا أيضًا غرضًا محتملاً لآلية الترجمة هذه. تحت الضغط ، يمكن للخلايا أن تقلل من تنظيم الترجمة التقليدية ، مما يحد من إنتاج البروتينات الفيروسية في حالة الإصابة بالعدوى ، ولكنه يمنع أيضًا تكوين المستضدات اللازمة لإيقاف الخلايا التائية من أجل الاستجابة المناعية. هنا ، Schwab et al. أبلغ عن أن الببتيدات التي تبدأ بـ leucine تم إنتاجها في غياب البروتين eIF2 ، والذي يساعد عادةً في تخليق الببتيد الذي يبدأ بـ AUG. تعمل الخلايا تحت الضغط على إبطاء الترجمة التقليدية عن طريق تقييد وظيفة eIF2. لذلك ، قد توفر الترجمة التي تبدأ بـ CUG ، والتي تعمل بدون eIF2 ، مخرجًا للخلايا المجهدة التي تحتاج إلى تكوين الببتيدات. قد يكون هذا البديل طريقة رائعة لتجنب ضخ البروتينات الفيروسية مع الاستمرار في إنشاء مستضدات لمراقبة الخلايا التائية # x02014 ما لم تستغل الفيروسات بالطبع الثغرة لإنتاج الببتيد الخاص بها.


نتائج ومناقشة

لقد اخترنا 5 ′ -UTR من المدروس جيدًا S. cerevisiae CYC1 المروج [15 ، 16]. صهرنا pCYC1min (بدءًا من الموضع 143) في بروتين الفلورسنت الأخضر المعزز بالخميرة (yEGFP) [17] و CYC1 فاصل. بالمقارنة مع كامل CYC1 المروج ، يحتوي pCYC1min على اثنين من صناديق TATA الثلاثة ولا يوجد تسلسلات تنشيط أولية. يعد pCYC1min معززًا ضعيفًا إلى حد ما ، ولهذا السبب ، يبدو أنه مرشح مثالي لاكتشاف كل من التأثيرات الإيجابية والسلبية للطفرات النقطية في تسلسل القائد على التعبير عن بروتين المراسل النهائي. ال CYC1 المروج 5 -UTR يبلغ طوله 71 نيوكليوتيد.

في التحليل التالي ، نشير إلى جزء من CYC1 5 ′ -UTR في الموضع 1 إلى −8 مثل تمديد تسلسل كوزاك وذلك عند 9 إلى −15 مثل منطقة المنبع. في تسلسل كوزاك الممتد ، يتم حفظ الأدينين بقوة في خمسة مواضع ، بينما في منطقة المنبع لا يتم حفظ أي نوكليوتيد بقوة. ومع ذلك ، فإن الأدينين هو الأكثر شيوعًا في كل موقع تقريبًا (انظر الخلفية).

تسلسل كوزاك الممتد

الأصلي CYC1 التسلسل من المواضع 15 إلى −1 هو CACACTAAATTAATA (يشار إليه فيما بعد باسم ك 0). وفقًا لـ Dvir et al. [9] ، وجود الأدينين في المواضع 1 و −3 و 4 ، جنبًا إلى جنب مع غياب الجوانين في الموضع −2 ، يجب أن يجعل تسلسل القائد هذا مثاليًا تقريبًا للتعبير العالي. ومع ذلك ، فإن الثايمين في الموضع −2 والسيتوزين في الموضع 13 لهما تردد أقل من 20 % و 10 %، على التوالي ، من بين معبر عنها للغاية S. cerevisiae الجينات [8]. بنينا أول مادة اصطناعية لدينا CYC1 تسلسل القائد (ك 1) عن طريق وضع الأدينين في كل موضع من −1 إلى 15.

مستوى التألق المرتبط بـ ك 1 كان 6.5 % أعلى من ذلك الذي تم قياسه بـ ك 0. ومع ذلك ، لم يظهر أي فرق ذي دلالة إحصائية من البيانات التي تم جمعها في هذين التسلسل الرئيسيين (ص- القيمة = 0.13). حافظنا ك 1 (تسلسل القائد المحسن) كقالب للبنى التركيبية التالية وقمنا ببناء 57 أكثر اصطناعية 5 ′ -UTRs عن طريق تحور النيوكليوتيدات المفردة أو المتعددة في ك 1.

تم إجراء المجموعة الأولى من متواليات الزعيم الاصطناعي بواسطة طفرة نقطة واحدة من الموضع 1 إلى الموضع 8 (انظر الجدول 1). ومن ثم ، قمنا بتعديل تسلسل Kozak الممتد فقط ، بينما تم الاحتفاظ بمنطقة المنبع في تكوين محسن للتعبير الجيني العالي مع الأدينينات في المواضع −9 إلى −15.

تم تسجيل أعلى تألق ل ك 16 (حيث استبدل الجوانين الأدينين في الموضع 5) والأدنى بـ ك 9 (حيث حل الثايمين محل الأدينين في الموضع 3). علاوة على ذلك ، فإن مستوى الفلورة ك 16 كان مختلفًا بشكل كبير إحصائيًا عن ك 0 و ك 1. كان التحسن في التألق الناتج عن الجوانين في الموضع 5 نتيجة مفاجئة لأن الجوانين هو أقل نيوكليوتيدات تكرارية في الخميرة S. cerevisiae تسلسل الزعيم. علاوة على ذلك ، لم يتم اكتشاف أي جوانين في هذا الموضع بين الجينات المعبر عنها بشكل كبير [8] أو أثار أي تعزيز مضان في عمل Dvir et al. [9].

على الرغم من عدم وجود فروق ذات دلالة إحصائية من ك 1، البنيات الوحيدة بخلاف ك 16 مما أدى إلى زيادة GT5 % على مستوى الأسفار ك 1 كانت ك 3, ك 10، و ك 24. على وجه الخصوص ، في ك 3، حل الثايمين محل الأدينين في الموضع 1 ، وفي ك 10 تم تحور الأدينين في الموضع 3 إلى جوانين. كما ذكر أعلاه ، يجب أن يضمن الأدينين في الموضعين 1 و 3 تعبيرًا جينيًا عاليًا. ومع ذلك ، في مثل هذه الخلفية الأدينينية ، يبدو أن النيوكليوتيدات الأقل تكرارًا في المواضع 1 أو 3 مطلوبة لزيادة تعزيز التعبير الجيني.في المقابل ، ثايمين بدلاً من الأدينين في الموضع 3 (ك 9) كانت الطفرة الوحيدة التي تسببت في حدوث a & gt5 % تقليص في ك 1 مستوى مضان. تتوافق هذه النتيجة مع الملاحظة في [9] أن الثايمين في الموضع 3 متوفر بكثرة في الجينات ضعيفة التعبير (الشكل 1 أ).

تأثير الطفرات النقطية في تسلسل كوزاك الممتد على التعبير الفلوري. يتم رسم مستويات الإسفار بالنسبة ل ك 1 (أ) و ك 0 (ب). يتوافق التحكم مع سلالة الخميرة بدون جين yEGFP. النيوكليوتيد الذي حل محل الأدينين في ك 1 والموضع الذي حدثت فيه الطفرة مذكور أسفل اسم كل تسلسل قيادي اصطناعي. النجمة ، ص-القيمة & lt0.05 مقابل. ك 1 (أ) أو ك 0 (ب)

بالنسبة إلى ك 0، احتوت جميع التسلسلات الجديدة للزعيم الاصطناعي البالغ عددها 25 على ما بين ستة وثمانية طفرات. بعيدا عن ك 9، أظهرت جميع التركيبات 5 ′ -UTRs مستوى مضان أعلى من ذلك ك 0، خمسة منها كانت أعلى بكثير. وشملت هذه المواضع −1 و −4 و 5. كما لوحظ بالفعل في المقارنة مع ك 1، يبدو أن الأدينين المنبع للتو من كودون START ليس ذا فائدة خاصة للتعبير الجيني. هنا ، سيتوزين وثايمين (ك 2 و ك 3، على التوالي) أفضل بكثير من الأدينين. ومع ذلك ، فيما يتعلق ك 0، كان هناك سبع طفرات نقطية أخرى في المنبع. في الموضع −4 ثايمين (ك 12) أدى إلى أعلى زيادة مضان ، بينما في الموضع 5 ، كلاهما سيتوزين (ك 14) وجوانين (ك 16) مضان محسن إلى GT10 % فوق ذلك من ك 0. حيث ك 0 يحتوي على ثايمين في المواضع 2 و 5 و 6 ، كل من الخمسة الاصطناعية 5 ′ -UTRs التي أظهرت اختلافات ذات دلالة إحصائية من ك 0 تأثرت بطفرة نقطية في موقعين متجاورين أو أكثر. ثلاث سلاسل قيادية اصطناعية أخرى (ك 10,ك 17، و ك 24) تسبب في & GT10 % زيادة في التألق مقارنة ب ك 0، على الرغم من أن هذه الاختلافات لم تكن كبيرة (ص-القيمة و GT0.05). ك 10 و ك 17 كان لديها أيضًا طفرات مزدوجة في المواقع المجاورة (الشكل 1 ب).

طفرات متعددة للجوانين

أعطى تحليل أول 25 تسلسلًا اصطناعيًا 5 ′ -UTR نتيجة مفاجئة وهي أن طفرة نقطة واحدة إلى الجوانين - والتي تغيب أساسًا عن تسلسل كوزاك الممتد للتعبير بدرجة عالية S. cerevisiae الجينات - يمكن أن تعزز مستوى التألق ك 1، تسلسل قيادي مُحسَّن للتعبير الجيني. علاوة على ذلك ، خمسة من 5 ′ -UTRs الاصطناعية لدينا لا لبس فيه (& GT9 %) زاد من مستوى التألق المرتبط بـ pCYC1min.

وفقًا لبياناتنا ، يمكن لطفرة واحدة في الجوانين أن تعزز التعبير الجيني. ومع ذلك ، ذكرت ورقتان سابقتان [18 ، 19] أن العديد من الجوانين الموضوعة أمام كودون ستارت من شأنه أن يقلل بشكل كبير من تخليق البروتين. لذلك ، قمنا بتقييم كيفية تأثير الطفرات النقطية المتعددة على الجوانين على كفاءة ترجمة pCYC1min ، لتحديد ما إذا كان يمكن استخدامها لتعديل التعبير الجيني.

وفقا ل [8] ، من بين أعرب للغاية S. cerevisiae الجوانين هو أقل نيوكليوتيدات تكرارا بين الموضعين 1 و 15 ، باستثناء الموضع 7 ، حيث يكون السيتوزين أقل النوكليوتيدات تكرارا. قمنا ببناء 5 ′ -UTR الاصطناعية التي تعكس هذا التسلسل (ك 26 الجدول 2). هذا التعبير الجيني المغلق ، كما يتضح من مستوى التألق المقابل لا يختلف اختلافًا كبيرًا (ص-القيمة = 0.21) من سيطرتنا السلبية (أ S. cerevisiae سلالة لا تحتوي على جين yEGFP).

اختبرنا ما إذا كانت الطفرات المتعددة للجوانين (السيتوزين في الموضع −7) ستؤثر على التعبير الجيني بطريقة مختلفة عندما غطت إما تسلسل كوزاك الممتد بالكامل (ك 27) أو منطقة المنبع (ك 28). منذ أن تم إجراء الطفرات فيما يتعلق ك 1، كل المواقع غير المتحولة تحتوي على الأدينين. بشكل مفاجئ ، وجدنا أن التكوينين كانا متكافئين للتعبير الجيني (ص-القيمة & gt0.40) ومخفضة ك 1 مستوى الفلورة بمقدار النصف تقريبًا.

بدءا من ك 27، استبدلنا الجوانين في المواضع 1 (ك 29), −2 (ك 30) و 3 (ك 31) مع الأدينين لتحديد ما إذا كان الأدينين الفردي في المواضع الثلاثة التي تلي كودون START سيعزز التعبير الفلوري عندما تشغل المواقع الأخرى لتسلسل Kozak الممتد إما غوانين أو سيتوزين. في الموضع −1 ، لم يظهر الأدينين أي تحسن في مضان ك 27. ومن المثير للاهتمام ، أنه في الموضعين 2 و 3 ، تسبب الأدينين في انخفاض في التعبير الجيني إلى ما يقرب من 7 % التابع ك 1 مستوى مضان. تظهر هذه النتائج أن الأدينين في حد ذاته لا يمكن تحسين التعبير الجيني حتى عندما تحتل الموضع −3 أو 1. بشكل عام ، يمكننا أن نستنتج أن التأثير على التعبير الجيني لطفرة نقطة واحدة في التسلسل الرئيسي يعتمد بشدة على السياق.

أخيرًا ، لفهم مدى أهمية منطقة المنبع بشكل أفضل للتعبير الجيني ، قللنا تدريجياً عدد الجوانين من سبعة (ك 28) لواحد (ك 38). بدءًا من الموضع −9 ، استبدلنا الجوانين بالأدينين في كل خطوة ورأينا أن مستوى التألق زاد بشكل خطي تقريبًا مع عدد الأدينينات (الشكل 2 وملف إضافي 1). التسلسل الأخير الذي كان مستوى التألق فيه مختلفًا إحصائيًا اختلافًا كبيرًا عن ذلك من ك 1 كنت ك 36، حيث كانت الجوانين موجودة في المواقف من 13 إلى 15. الجوانين وحده في الموضع 15 أو مصحوبًا بآخر في الموضع −14 لم ينتج عنه اختلاف كبير في مستوى التألق عن مستوى ك 1. لذلك ، حتى في وجود تسلسل Kozak الممتد المحسن للتعبير الجيني العالي ، فإن الطفرات المتعددة في منطقة المنبع لها تداعيات واضحة على تخليق البروتين ويمكن استخدامها كوسيلة لضبط وفرة البروتين. يتم تقديم شرح لهذه النتيجة في قسم التحليل الحسابي أدناه. ومن المثير للاهتمام أن أربعة جوانين مختلطة مع الأدينين (ك 33) في منطقة المنبع مخفضة ك 1 مضان إلى حد أصغر من أربعة جوانين على التوالي (ك 32) ، مما يوفر مزيدًا من التأكيد على أن التأثير على التعبير الجيني للطفرات النقطية داخل 5 ′ -UTR يعتمد بشكل كبير على السياق النووي (الشكل 2 ، انظر الملف الإضافي 1 للمقارنة مع ك 0 ضوئي).

طفرات نقطية متعددة للجوانين. النسبة بين مستوى مضان الاصطناعية 5 ′ -UTRs من ك 26 إلى ك 38 وذلك من ك 1 تم عمل تقرير لها. يتم إعطاء عدد الأدينينات أو الجوانين في منطقة المنبع أسفل اسم تسلسل القائد (من ك 27 إلى ك 38). تشير الرموز الفرعية −1 و 2 و 3 إلى أن الأدينين موجود في تسلسل كوزاك الممتد فقط في الموضع المقابل. مخطوطة أنا يمثل مختلط (انظر النص الرئيسي). النجمة ، ص-القيمة & lt0.05 مقابل. ك 1

منطقة المنبع

أكد التحليل السابق أن التأثير على التعبير الجيني بسبب الطفرات الفردية والمتعددة داخل 5 ′ -UTR يعتمد بشدة على السياق. علاوة على ذلك ، أظهرت بياناتنا بوضوح أن التغييرات ليس فقط في تسلسل كوزاك ولكن أيضًا داخل منطقة المنبع تؤثر بشكل ملحوظ على التعبير الجيني. لذلك أجرينا طفرات نقطية على ك 1 بين الموضعين 9 و 15 (الجدول 3) لتقييم ما إذا كان النيوكليوتيد الفردي المختلف عن الأدينين يمكنه تغيير معدل الترجمة عند وضعه في منطقة المنبع.

جميع الطفرات النقطية (باستثناء واحد في ك 38) أدى إلى مستوى مضان أعلى من المستوى المرتبط بـ ك 1. والجدير بالذكر ، في ثماني حالات ، كانت الزيادة في التألق ذات دلالة إحصائية (& GT10 % اعلى من ك 1 ضوئي). تضمنت هذه الطفرات الثمانية أربعة مواضع متجاورة ، من -11 إلى -14. لم يتم أخذ أي من هؤلاء في الاعتبار في العمل المرجعي بواسطة Dvir et al. [9].

في الموضع −11 ، الجوانين بدلاً من الأدينين (ك 47) تعزيز التعبير عن طريق مضان & GT15 %، في حين أن السيتوزين والثايمين لم يكن لهما تأثيرات معنوية. كل طفرة في الموضع −12 زادت من تألق ك 1. أكبر تغيير (& GT15 %) كان بسبب الجوانين (ك 50). كما تم تعزيز الطفرات في الموضع −13 بقوة ك 1 مستوى مضان. طفرات نقطية - السيتوزين (ك 51) وجوانين (ك 53) - نتج عنها فروق ذات دلالة إحصائية في التألق من ك 1، في حين أن الثايمين (ك 52) المعزز ك 1 مضان بحوالي 14 % لكن هذا لم يصل إلى دلالة إحصائية. وتجدر الإشارة إلى أنه من بين جميع 58 -UTRs الاصطناعية لدينا ، ك 51 كان لديه أعلى مستوى من التألق - ما يقرب من 17 % أعلى من ك 1.

أخيرًا ، أدت طفرتان نقطيتان مختلفتان في الموضع 14 إلى زيادة التألق: السيتوزين (ك 54) وثايمين (ك 55) (الشكل 3 ، انظر الملف الإضافي 1 للمقارنة مع ك 0).

تأثير طفرات النقطة في منطقة المنبع على التألق بالنسبة ل ك 1. النيوكليوتيد الذي حل محل الأدينين في ك 1 والموضع الذي حدثت فيه الطفرة مذكور أسفل اسم كل تسلسل قيادي اصطناعي. النجمة ، ص-القيمة & lt0.05 مقابل. ك 1

معًا ، تؤكد نتائج هذا التحليل الأخير لمنطقة المنبع على نتيجة مفاجئة أخرى: طفرات النقطة الواحدة في بداية تسلسل كوزاك ، لا سيما في الموضعين −12 و 13 ، كانت تلك التي عززت التعبير الجيني من سياق غني بالأدينينات.

التحليل الحسابي

أجرينا عمليات محاكاة باستخدام RNAfold لاستقصاء الارتباطات المحتملة بين الهياكل الثانوية للـ mRNA المحسوبة ، جنبًا إلى جنب مع الحد الأدنى من الطاقات الحرة المقابلة (MFEs) ، ومستويات التألق المقاسة. يقدم تحليلنا تفسيرًا للانخفاض في التألق بسبب الطفرات المتعددة من الأدينين إلى الجوانين (والسيتوزين) في منطقة −15 ... −1. في المقابل ، لم يظهر أي تبرير معقول لتأثيرات طفرات النقطة المفردة على كفاءة الترجمة من عمليات المحاكاة باستخدام RNAfold.

كمدخل لـ RNAfold ، استخدمنا تسلسلات mRNA بدءًا من موقع بدء النسخ لـ pCYC1min [16] وتنتهي في موقع poly-A من CYC1 فاصل [20]. كان طول كل تسلسل 937 نيوكليوتيد. من عمليات المحاكاة الأولية ، لاحظنا أن سلسلة poly-A بطول متغير يتراوح من 150 إلى 200 نيوكليوتيدات لم يكن لها تأثير كبير على طي الرنا المرسال. تم حساب جميع الهياكل الثانوية للـ mRNA عند 30 درجة مئوية (درجة الحرارة التي نمت عندها S. cerevisiae خلايا لتجارب FACS).

ك 0 و ك 1 لديك نفس MFE: −241.21 كيلو كالوري / مول. هذا هو الأعلى - والأكثر شيوعًا - ضمن مجموعة من 59 سلسلة تم تحليلها في هذا العمل (انظر ملف إضافي 1). يتميز الهيكل الثانوي mRNA المقابل لهذا MFE بوجود a دبوس الشعر العملاق بين المواضع −40 و +10. تنتقل حلقة دبوس الشعر من الموضع 31 إلى الموضع +1 وتحتوي على جزء 5 ′ -UTR بالكامل الذي استهدفناه هنا. يتكون جذع دبوس الشعر من تسعة أزواج قاعدية ، أعطى واحد منها "عدم تطابق" بسبب الأدينين في الموضع 38 و +8 (انظر الشكل 4 أ).

الهياكل الثانوية مرنا. أ أ دبوس الشعر العملاق موجود في البنية الثانوية mRNA المقابلة لـ MFE لكليهما ك 0 و ك 1. تحتوي حلقة دبوس الشعر على منطقة 15… −1. جزء من 5 ′ -UTR في تحليلنا خالٍ من أي تفاعلات اقتران في تكوينه من النوع البري (ك 0) وفي ذلك تم تحسينه نظريًا للتعبير العالي للبروتين (ك 1). يتم تقليل حلقة دبوس الشعر العملاق ك 4 بسبب تفاعل الاقتران الأساسي بين الجوانين في الموضع −1 والسيتوزين في الموضع −31. في كل بنية مرنا معروضة ، يشير السهم الأخضر إلى الموضع +1 ، ويشير السهم الأحمر إلى الموضع −15. ب يؤدي تعطيل دبوس الشعر العملاق إلى انخفاض في MFE للبنية الثانوية mRNA. ك 26 و ك 31 أقل المؤسسات المالية الأصغر المحسوبة في تحليلنا. يحتوي التسلسلان على العديد من الجوانين في تسلسل Kozak الممتد المتضمن في تفاعلات الاقتران مع CDS. يوجد نمط مماثل أيضًا في ك 30. هنا ، مع ذلك ، تؤدي حلقة مصغرة ثانية حول كودون START إلى زيادة في MFE. MFE من ك 26 أقل بكثير من تلك الخاصة بـ ك 30 و ك 31 بسبب وجود ساق آخر بسبب التفاعلات المزدوجة بين منطقة المنبع و CYC1 فاصل. ومع ذلك ، فإن مستويات التألق ك 30 و ك 31 هي فقط ما يقرب من 1.2 ضعف أعلى من ك 26

تؤدي الطفرات المتعددة إلى الجوانين إما في منطقة المنبع أو تسلسل كوزاك الممتد إلى تفاعلات الاقتران الأساسي بين ، على الأقل ، جزء من منطقة 15 ... −1 و CDS (yEGFP) أو CYC1 فاصل. نتيجة لذلك ، يتم تدمير دبوس الشعر العملاق واستبداله بواحد أو اثنين من السيقان التي تخفض MFE للبنية الثانوية mRNA (الجدول 2). ارتبطت معظم قيم MFE الأصغر من 241.21 kcal / mol بمستويات مضان أقل من تلك الموجودة في ك 1 (الشكل 5). تتوافق هذه النتيجة مع الفكرة المدعومة أيضًا [8 ، 9] ، القائلة بأن الهياكل الثانوية للـ mRNA المستقرة في 5 ′ -UTR تقلل من التعبير البروتيني. ومع ذلك ، فإن مستويات التألق التي قمنا بقياسها لم تزد بشكل متناسب مع الزيادات في MFE. علاوة على ذلك ، في حالتين (ك 32 و ك 36) تنبأ RNAfold بوجود منعطف شعر عملاق في بنية mRNA ، في حين أن مستويات التألق من تجاربنا كانت أقل بكثير من تلك الموجودة في ك 1 (الشكل 5 وملف إضافي 1).

ترتبط قيم MFE المنخفضة بتعبير مضان منخفض. أشرطة حمراء، الفرق بين MFEs المقابلة 5 ′ -UTR و ك 1 (ΔMFE). الحانات الزرقاء، نسبة مكبرة بمقدار 10 أضعاف بين مستوى التألق المشار إليه 5 ′ -UTR ومستوى ك 1. بعيدا عن ك 1، التسلسلات مرتبة حسب الزيادة ΔMFE. كل التسلسلات ما عدا ك 4 تحتوي على طفرات نقطية متعددة فيما يتعلق ك 1. العلامات النجمية أعلاه أشرطة زرقاء, ص-القيمة & lt0.05 مقابل. ك 1

ك 26 تم تصميمه عن طريق اختيار النيوكليوتيدات الأقل تكرارًا بين الموضعين 15 و 1 من بين مجموعة من النيوكليوتيدات التي يتم التعبير عنها بشكل كبير S. cerevisiae الجينات. كان MFE المقابل (−261.39 kcal / mol) هو الأدنى ضمن مجموعة وحدات النسخ التي تم النظر فيها في هذا العمل. لم يكن هناك دبوس شعر عملاق موجود في البنية الثانوية MFE mRNA حيث تم عزل المنطقة −15… −1 إلى ساقين مختلفين. كانت الجوانين بين الموضعين 1 و 6 جزءًا من جذع طويل وتم إقرانها بسداسية في بداية تسلسل yEGFP (المواضع +33 إلى +38). في المقابل ، المواضع من 9 إلى 15 مقترنة بمنطقة من CYC1 فاصل ، في المواضع +750 إلى +758 (الشكل 4 ب).

مستوى مضان أعلى بقليل من ك 26 تم تسجيله ل ك 30 و ك 31. كلاهما اختلف عن ك 26 لمنطقة المنبع (مصنوعة من سبعة أدينينات) ووجود الأدينين في منطقة كوزاك الممتدة (في الموضعين 2 و 3 ، على التوالي). مشابه ل ك 26، أول خمسة نيوكليوتيدات من منطقة كوزاك الممتدة ك 30 وأول ستة من ك 31 تم عزلها في جذع مع CDS. ومع ذلك ، بشكل مختلف عن ك 26، مناطق المنبع ك 30 و ك 31 كانت خالية تمامًا من أي تفاعلات اقتران (انظر الشكل 4 ب). كانت MFEs الخاصة بهم (−244.28 و 247.26 kcal / mol ، على التوالي) أعلى بكثير من تلك الخاصة بـ ك 26. تشير هذه التسلسلات الثلاثة إلى أن شرطًا لخفض تعبير البروتين بشكل ملحوظ هو إحاطة النيوكليوتيدات في المواضع 1 إلى 5 في بنية ثانوية مرنا. علاوة على ذلك ، لا يتعين على كل هذه النيوكليوتيدات المشاركة في تفاعلات الاقتران الأساسي. في الواقع ، الجوانين في الموضع 1 (ك 30) أو −2 (ك 26 و ك 31) "مجاني" ومسؤول عن وجود حلقة صغيرة في بنية الرنا المرسال.

ومع ذلك ، فإن هذه الفرضية يتناقض مع ك 29. MFE لهذا التسلسل (−245.97 kcal / mol) يمكن مقارنته مع ك 30 و ك 31، والبنية الثانوية mRNA المقابلة تشبه إلى حد بعيد تلك الخاصة بـ ك 31 (الشكل 6 أ). ومع ذلك ، فإن مستوى التألق المرتبط بـ ك 29 كان أكثر من 6 أضعاف من ك 31 وبلغت 45٪ من أن ك 1.

الهياكل الثانوية مرنا. أ ك 27 يختلف عن ك 29 فقط بواسطة الجوانين بدلاً من الأدينين في الموضع 1. ومع ذلك ، فإن هياكلها الثانوية mRNA تختلف. في ك 27، فإن تسلسل Kozak الممتد متورط في تفاعلات الاقتران الأساسي مع CYC1 فاصل ، بينما في ك 29 يتم قفل تسلسل Kozak الممتد في جذع مع CDS. MFE المرتبط بـ ك 27 أقل من ك 29، ولكن لا يوجد فرق بين مستويات التألق للتسلسلتين (ص- القيمة = 0.20). ب تؤدي الجوانين المتعددة في منطقة المنبع إلى ظهور هياكل mRNA التي تتميز بتفاعلات الاقتران الأساسي بين 5 ′ -UTR و CYC1 فاصل. ك 28 و ك 34 لديك ستة جوانين في الجذع مع CYC1 فاصل ، حيث ك 35 لديها فقط 5 جوانين في هيكل مماثل. يؤدي هذا إلى زيادة في MFE وبالتالي زيادة الفلورة

ك 27 مشتركة مع ك 29ك 31 منطقة المنبع مصنوعة فقط من الأدينينات. ومع ذلك ، على عكس هذه المتواليات الثلاثة ، فإن تسلسل Kozak الممتد لـ ك 27 لا تحتوي على أي أدينين. MFE من ك 27 (−247.04 كيلو كالوري / مول) كانت قابلة للمقارنة مع ك 29ك 31، لكن هيكلها الثانوي mRNA المقابل له تكوين مختلف. في الواقع ، كانت جميع النيوكليوتيدات في تسلسل Kozak الممتد (باستثناء السيتوزين في الموضع 7) متورطة في تفاعل الاقتران الأساسي ليس مع CDS ولكن مع CYC1 المنهي (المواضع +755 إلى +762 الشكل 6 أ). مستوى التألق ك 27 كان أعلى بقليل من ك 29، أي ما يقرب من 7 أضعاف حجم ك 31.

التسلسلات الخمسة التي تم النظر فيها حتى الآن (ك 26, ك 27, ك 29ك 31) تشترك في منطقة كوزاك ممتدة غنية بالجوانين التي تم عزلها في جذع في البنية الثانوية MFE mRNA. في أربع حالات ، تم إقران تسلسل Kozak الممتد (جزئيًا) مع CDS ، وفي حالة واحدة (ك 27) مع ال CYC1 فاصل. MFE من ك 26 كان الأدنى ، حيث تم عزل منطقة المنبع أيضًا في ساق. أظهرت التسلسلات الأربعة الأخرى قيم MFE متشابهة جدًا ولكن مستويات تألق مختلفة.

مجموعة التسلسلات الأخرى المتأثرة بطفرات متعددة فيما يتعلق ك 1 كان لديه فقط الأدينينات في تسلسل كوزاك الممتد وعدد متغير من الجوانين في منطقة المنبع.

ك 28, ك 34، و ك 35 كان ، على التوالي ، 7 و 6 و 5 جوانين على التوالي من الموضع 15 في اتجاه مجرى النهر. على الرغم من أن MFE من ك 35 كان من الواضح أنه أعلى من ك 28 و ك 34 (الجدول 2) ، أدت التسلسلات الثلاثة إلى ظهور هياكل mRNA مماثلة حيث تم قفل خمسة جوانين على الأقل من منطقة المنبع (بالإضافة إلى أول أدينين في اتجاه مجرى النهر) في جذع بسبب تفاعلات الاقتران الأساسي مع CYC1 فاصل (انظر الشكل 6 ب).

ومن المثير للاهتمام أن كل من مستوى MFE والفلورة ك 28 كانت قابلة للمقارنة مع ك 27 و ك 29. ومن ثم ، حتى لو كان تسلسل كوزاك خاليًا من تفاعلات الاقتران ، فإن عزل منطقة المنبع في ساق كان كافياً لضمان انخفاض واضح في تعبير البروتين. هذا تأكيد إضافي للدور الذي تلعبه النيوكليوتيدات في بداية تسلسل كوزاك في ضبط التعبير البروتيني.

تم الحصول على بنية ثانوية مختلفة لـ MFE mRNA لـ ك 33 (أربعة جوانين مختلطة مع الأدينينات) ، حيث شارك نصف تسلسل كوزاك الممتد ومنطقة المنبع بأكملها تقريبًا في تفاعلات الاقتران الأساسي مع CDS ، مما أدى إلى ظهور جذع طويل. ومع ذلك ، بالمقارنة مع ك 35، حيث تم قفل خمسة نيوكليوتيدات فقط من منطقة المنبع في جذع باستخدام CYC1 فاصل ك 33 أظهر MFE أعلى وكذلك مستوى مضان أعلى (الشكل 5 وملف إضافي 1).

أخيرًا ، لـ ك 32, ك 36، و ك 37 (مع أربعة وثلاثة وجوانين في منطقة المنبع ، على التوالي) أعاد RNAfold نفس MFE كما في ك 1. تميزت جميع الهياكل الثانوية للـ mRNA المقابلة بوجود دبوس الشعر العملاق (انظر الملف الإضافي 1). مقارنة ببياناتنا التجريبية ، كانت هذه النتيجة معقولة فقط لـ ك 37 ولكن في خلاف واضح مع القياسات ل ك 32 و ك 36، التي كانت مستويات الفلورة أقل بكثير من تلك ك 1 (الشكل 5). على وجه الخصوص ، مضان ك 32 يتوافق فقط مع حوالي 69 ٪ من ذلك ك 1. لذلك ، يمكن القول أنه في الجسم الحي ك 32 و ك 1 تشترك في نفس البنية الثانوية MFE و mRNA ، كما هو مقترح في محاكاة السيليكو.

على عكس الطفرات متعددة النقاط ، فإن الطفرات ذات النقطة الواحدة على ك 1، فقط ك 4 تسبب في تعديل هيكل دبوس الشعر العملاق وبالتالي انخفاض في MFE. ك 4 يحمل جوانين في الموضع 1 يتزاوج مع السيتوزين في الموضع −31 بحيث يتم تقليل طول الحلقة من 32 إلى 29 نيوكليوتيد ويتم خفض MFE إلى −241.42 كيلو كالوري / مول (الشكل 4 أ). وفقًا لبياناتنا ، فإن هذا التغيير البسيط ليس له أي تأثير على تعبير الفلورة. جميع الطفرات النقطية الأخرى التي تسببت في مستوى مضان أعلى بكثير من مستوى ك 1 (يسمى، ك 16, ك 47ك 51، و ك 53ك 55) من خلال نفس MFE والهيكل الثانوي المقابل mRNA مثل ك 1، وفقًا لمحاكاة RNAfold.


شكر وتقدير

نشكر J. Cleveland و J. Joyce وأعضاء مختبر Karbstein للتعليقات. تم دعم هذا العمل من قبل المعاهد الوطنية الأمريكية للصحة (منح R01-GM086451 (إلى KK) و F31-GM116406 (إلى MBF)) ، PGA National (زمالة يوم التوعية بسرطان النساء إلى HG) ، ومؤسسة Richard & amp Helen DeVos (خريجة) زمالة لـ MBF) ، ومعهد هوارد هيوز الطبي (منحة الباحث الجامعي 55108536 إلى KK). المحتوى هو مسؤولية المؤلفين فقط ولا يمثل بالضرورة وجهات النظر الرسمية للمعاهد الوطنية الأمريكية للصحة.


كيف يمكن لتسلسل SD / Kozak الجيد أن يعزز كفاءة الترجمة؟ - مادة الاحياء

1. قسم الأحياء ، كلية العلوم ، جامعة أوتاوا ، أوتاوا ، كندا

2. معهد أوتاوا لبيولوجيا النظم ، أوتاوا ، أونتاريو ، كندا

* مراسلة: شوهوا شيا

محرر أكاديمي: جويب جيرايدز

تم الاستلام: 9 يونيو 2019 | وافقت: 14 أكتوبر 2019 | نشرت: 17 أكتوبر 2019

علم الوراثة OBM 2019، المجلد 3 ، الإصدار 4 ، دوى: 10.21926 / obm.genet.1904097

الاقتباس الموصى به: تحسين بدء ترجمة Phage. علم الوراثة OBM 20193 (4): 16 دوى: 10.21926 / obm.genet.1904097.

ونسخ 2019 من قبل المؤلفين. هذا مقال مفتوح الوصول يتم توزيعه وفقًا لشروط المشاع الإبداعي بواسطة ترخيص الإسناد ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ بأي وسيط أو تنسيق ، بشرط الاستشهاد بالعمل الأصلي بشكل صحيح.

الملخص

يجب أن يكون Phage كعامل مضاد للبكتيريا فعالاً في قتل البكتيريا ، وبالتالي يحتاج إلى التكاثر بكفاءة. يعد إنتاج البروتين خطوة مقيدة في التكرار في جميع أشكال الحياة تقريبًا ، بما في ذلك العاثيات. يعتمد إنتاج البروتين الفعال على كفاءة بدء الترجمة والاستطالة والإنهاء ، حيث غالبًا ما يكون بدء الترجمة يحد من المعدل. يتم فك تشفير إشارات البدء مثل متواليات Shine-Dalgarno (SD) وكودون البدء بواسطة متواليات مضادة لـ SD وبدء الحمض الريبي النووي النقال (tRNA) ، على التوالي. بينما لا يمكن تعديل آلية فك التشفير بسهولة ، يمكن تصميم الإشارات لزيادة كفاءة فك التشفير. أراجع هنا فهمنا لآلية الترجمة لتسهيل هندسة إشارات بدء الترجمة المثلى لتسهيل تصميم جينات ترميز بروتين الملتهمة ، بما في ذلك 1) التوصيف الدقيق للنهاية 3 & rsquo لـ 16S rRNA باستخدام بيانات RNA-Seq ، 2) تحديد التفاعل الأمثل SD / aSD ، و 3) تقليل البنية الثانوية في التسلسلات التي تحيط بكودون البدء.

الكلمات الدالة

بدء الترجمة العوامل المضادة للبكتيريا العاثية

1 المقدمة

عادة ما يكون إنتاج البروتين هو الخطوة المحددة للمعدل في نمو الكائن الحي وتكاثره. من بين العمليات الفرعية الثلاث للترجمة ، أي بدء الترجمة والاستطالة والإنهاء ، غالبًا ما يكون البدء هو الخطوة المحددة [1,2,3,4,5,6]. لا تمتلك العاثيات عمومًا آلية الترجمة الخاصة بها ، وتعتمد على آلية الترجمة المضيفة لإنتاج البروتين [7]. على الرغم من أن بعض العاثيات تقوم بتشفير جينات الحمض الريبي النووي النقال في جينومها ، على سبيل المثال ، فإن بعض جينومات coliphage تشفر ما يصل إلى 20 جينة tRNA [8] ، قد تؤثر جينات الرنا الريباسي هذه في المقام الأول فقط على تجمع الرنا الريباسي واستطالة الترجمة ، ولكن ليس على بدء الترجمة. مع هذا الاعتماد على بدء ترجمة العاثيات على آلية ترجمة المضيف ، من المتوقع أن تتكيف جينات ترميز بروتين الملتهمة مع آلية ترجمة مضيفها وتتطور لاكتساب سمات التسلسل المميزة لجينات ترميز البروتين المضيف ، وخاصة الجينات المعبر عنها بدرجة عالية. وبالتالي ، فإن فهم ميزات التسلسل التي تعزز بدء الترجمة في البروتينات المضيفة سيسهل تصميم جينات ترميز بروتين الملتهمة بكفاءة عالية لبدء الترجمة.

يعتمد البدء الفعال في الأنواع البكتيرية بشكل أساسي على ثلاثة عوامل [4]: 1) تفاعل الاقتران الأساسي بين تسلسل Shine-Dalgarno (SD) المنبع لكودون البدء والتسلسل المضاد لـ SD (aSD) عند الذيل 3 & rsquo للوحدة الفرعية الصغيرة rRNA [9,10,11,12,13] ، 2) طبيعة كود البدء ، و 3) البنية الثانوية التي قد تتضمن SD وبدء كودون لإخفاء إشارات بدء الترجمة الأساسية هذه. تساهم هذه العوامل في كفاءة الريبوسومات التي يتم وضعها بشكل صحيح في كود البداية للانتقال من بدء الترجمة إلى الاستطالة. تم إحراز تقدم كبير نحو فهم دقيق لبدء الترجمة البكتيرية ، بما في ذلك قوة الاقتران المثلى والموضع بين SD و aSD ، وتأثير البنية الثانوية على بدء الترجمة. تغطي هذه المراجعة التطورات الأخيرة في هذين المجالين وأهميتها في تحسين فج مرنا لبدء الترجمة بكفاءة.

2. نموذج للتفاعل SD / aSD

تتمثل إحدى المهام الرئيسية لآلة الترجمة في تحديد كود البداية بناءً على الإشارات الموجودة في كودون البداية والمحاطة به. في أنواع الثدييات ، يمثل إجماع كوزاك على الرنا المرسال إشارة بدء ترجمة مهمة [14,15,16]. في البكتيريا ، يقع التفاعل بين تسلسل SD في الجزء العلوي من كودون البدء و aSD الموجود في الطرف 3 & rsquo المجاني من الرنا الريباسي الصغير للوحدة الفرعية [9,10,11,12,13,17] يعمل على توطين كودون البدء ، على الأرجح عن طريق الجمع ماديًا بين كودون البداية وبدء الحمض الريبي النووي النقال. نموذج الاقتران الأساسي بين SD و aSD [4,18,19] يوضح كيفية وضع كودون البدء مقابل anticodon لـ tRNA fMet (الشكل 1 أ ، ب). يتم تحفيز النموذج الرسومي جزئيًا من خلال الملاحظة التي تشير إلى أن الجينات المعبر عنها بشكل كبير في الإشريكية القولونية استخدام SDs مختلفة بمسافات مختلفة بين SD وكودون البدء (على سبيل المثال ، L.1 و أنا2 من أجل SD1 و SD2 في الشكل 1 أ). ومع ذلك ، فإنهم يتشاركون في نفس المسافة التي حددها Dللبدأ، والذي يتم تعريفه على أنه عدد القواعد من نهاية 3 & # 39 من الرنا الريباسي ssu (الوحدة الفرعية الصغيرة) إلى النيوكليوتيد قبل كودون البدء مباشرة (الشكل 1C ، D). دللبدأ يمكن حسابها بواسطة برنامج DAMBE [20]. كزيادة أو نقصان لـ Dللبدأ سيغير التجاور الأمثل بين كودون البدء وبدء الحمض الريبي النووي النقال (الشكل 1 أ ، ب) ، دللبدأ مقيد في نطاق ضيق [4,18,21] (الشكل 1E).

شكل 1 نموذج رسومي لتفاعل SD / aSD لتحديد متغير جديد Dللبدأ. (أ ، ب) رسم توضيحي تخطيطي لتفاعل SD / aSD ، مع وضع كودون البداية جنبًا إلى جنب مع anticodon لبدء tRNA ، مع نفس Dللبدأ لكن أطوال مختلفة للمقود (L1 و L2). (ج ، د) دللبدأ مثل عدد النيوكليوتيدات بين الطرف 3 و rsquo من ssu rRNA والنيوكليوتيدات قبل كودون البدء مباشرة. (هـ) دللبدأ مقيد بشدة في الداخل بكتريا قولونية الجينات الوظيفية المتعلقة بالجينات الكاذبة ، التي تم الحصول عليها باستخدام آخر 13 نيوكليوتيد في نهاية 3 & # 39 من ssu rRNA لـ بكتريا قولونية. (F) ضعف البنية الثانوية حول منطقة بدء الترجمة لتجنب تضمين تسلسل SD وبدء كودون في بنية ثانية. أعيد رسمه من وي وآخرون. [21] وشيا [19].

هو النطاق الضيق لـ Dللبدأ مقيد حقًا بالاختيار الذي يفضل الاقتران الأمثل SD / aSD؟ قد نعالج هذا السؤال من خلال التفكير في أنه إذا تم تخفيف الاختيار ، فعندئذٍ دللبدأ سينحرف التوزيع عن النطاق الضيق. الإشريكية القولونية يحتوي K12 على 306 جينات خادعة مشروحة في جينومها (NC_000913). لا تخضع هذه الجينات الخادعة للاختيار لزيادة كفاءة بدء الترجمة. توزيع دللبدأ بالنسبة لهذه الجينات الكاذبة ، يفقد الذروة ، مما يشير إلى أن توزيع Dللبدأ يتم الحفاظ عليه بالفعل عن طريق الاختيار. إذا انفصل أحد بكتريا قولونية الجينات إلى جينات معبر عنها بدرجة عالية ومنخفضة التعبير (تم تحديدها بواسطة HEGs و LEGs ، على التوالي) ، عن طريق ترتيبها إما عن طريق وفرة البروتين أو مؤشرات التكيف مع الكودون مثل ITE (فهرس استطالة الترجمة) [6,22] ، ثم تظهر HEGs أيضًا ذروة أكثر وضوحًا من LEGs. حساب دللبدأ، بالإضافة إلى مجموعة متنوعة من التحليلات الأخرى المتعلقة بتفاعل SD / aSD ، تم تنفيذها في برنامج DAMBE [20].

النموذج المفاهيمي في الشكل 1 أ والشكل 1 ب يلغي الالتباسات في الكتب المدرسية في البيولوجيا الجزيئية التي تتخذ تعريفا بسيطا لل SD مثل AGGAGG. يمكن للمرء أن يجد AGGAGG المنبع لكودون البدء مع Dللبدأ بعيدًا عن منطقة الذروة Dللبدأ (الشكل 1E). مثل هذا AGGAGG من غير المحتمل أن يكون SD. يمكن للمرء أيضًا العثور على غير AGGAGG الذي يمكن أن يقترن بنهاية 3 & rsquo من 16S rRNA للحصول على Dللبدأ الحق في منطقة الذروة. على سبيل المثال، لاسي لا يحتوي على AGGAGG ، ولكن لديه GGUGA يشكل اقترانًا أساسيًا SD / aSD والذي يحتوي على Dللبدأ = 13. وبالتالي ، فإن تعريف SD على أنها AGGAGG (أو AGGAGGU) يعد أمرًا مضللًا.

كثيرًا ما يصادف المرء عبارات تفيد بأن ستة نيوكليوتيدات بين AGGAGG وكودون البدء هي مسافة مثالية. مثل هذه التصريحات قد تكون صحيحة ل بكتريا قولونية لأن مثل هذا SD سيكون لها Dللبدأ من 14 بالقرب من ذروة دللبدأ (الشكل 1E). أي أن تيار AGGAGG المكون من ستة نيوكليوتيدات من كودون البدء يحتوي بالفعل على D الأمثلللبدأ. ومع ذلك ، فإن هذا التعريف لـ SD (على سبيل المثال ، AGGAGG متباعدة حول ستة نيوكليوتيدات في بداية كودون البدء) لن يكون قابلاً للتطبيق على SD في لاسي وهو GGUGA متباعدتان بين النيوكليوتيدات في بداية كودون البدء (الشكل 1 د). مع دللبدأ، لدينا الآن تعريف ثابت لتسلسلات SD بتنسيق بكتريا قولونية، أي ، أي تسلسل يمكن أن يقوم بزوج قاعدة ضد aSD لتحقيق Dللبدأ ما يقرب من 14. الأنواع البكتيرية المختلفة لها 3 و rsquo نهاية مختلفة من ssu rRNA وبالتالي يكون لها D مثالي مختلفللبدأ. على سبيل المثال ، الأمثل دللبدأ أطول في العصوية الرقيقة من في بكتريا قولونية [18]. باختصار ، دون الرجوع إلى النهاية 3 & rsquo لـ 16S rRNA ، غالبًا ما يكون من غير المعنى تحديد المسافة المثلى لتفاعل SD / aSD.

في حين أن تفاعل SD / aSD مهم لبدء الترجمة في غالبية mRNAs البكتيرية ، فهناك حالات لا يكون فيها تفاعل SD / aSD مطلوبًا لبدء الترجمة ، استنادًا إلى سطرين من الأدلة. أولاً ، لا يزال بإمكان الوحدة الفرعية الريبوسومية الصغيرة المُجمَّعة بـ 16S rRNA بدون 30 nt في النهاية 3 & rsquo بدء الترجمة في موقع البداية [23]. ثانيًا ، يمكن ترجمة mRNA عديم الرائد بكفاءة إلى هالوباكتيريوم ساليناروم [24] ، والذي يساهم في صياغة فرضية جديدة مفادها أن الحد الأدنى من المتطلبات لبدء الترجمة في البكتيريا هو كودون بدء يمكن الوصول إليه [25]. في البكتيريا سالبة الجرام ، كلا الصندوقين المصب [26] ، على سبيل المثال ، نموذج رئيسي لكودون البدء يساهم في بدء الترجمة ، وبروتين الريبوسوم S1 (RPS1) [27,28] كلاهما يساهم في بدء الترجمة في mRNAs مع SD ضعيف أو بدون SD على الإطلاق. يوجد

20٪ من الجينات الوظيفية في بكتريا قولونية جينوم K12 (NC_000913) الذي لا يحتوي على SD قابل للتحديد ضمن 20 قاعدة في بداية كودون البدء [19].

باختصار ، تستخدم معظم الجينات في البكتيريا تفاعل SD / aSD لتوطين كودون البدء ، خاصة في الجينات المعبر عنها بشكل كبير. قد يعمل النموذج الرسومي لتفاعل SD / aSD في الشكل 1 كإطار مفاهيمي لفهم الوضع الأمثل لإقران قاعدة SD / aSD. ومع ذلك ، يبدو أن الحد الأدنى من متطلبات بدء الترجمة هو رمز بدء يمكن الوصول إليه غير مضمن في البنية الثانوية.

3. توصيف دقيق لـ 3 & rsquo End of 16S Rrna بواسطة بيانات Rna-Seq

تكمن الصعوبة الرئيسية في توصيف تفاعل SD / aSD في أنه في حين تم توضيح جميع جوانب نضوج الرنا الريباسي 16S تقريبًا ، تظل خطوة النضج التي تتضمن النهاية 3 & rsquo لـ 16S rRNA غير معروفة لمعظم الأنواع البكتيرية [29,30]. وبالتالي ، فإن النهاية 3 و rsquo لـ 16S rRNA معروفة فقط بعدد قليل من الأنواع البكتيرية منذ عام 1980 [31] ، ولكنها غير معروفة لمعظم الأنواع البكتيرية. التنبؤ الحسابي [32,33] غالبًا ما يكون غير موثوق به [32,34,35,36] ، مع وجود العديد من الأخطاء الملحوظة [21]. على سبيل المثال ، إدخالات 16S rRNA لـ الأبراج العقدية (NC_002737) ، عصيات الجمرة الخبيثة (NC_005945) و البكتيريا المستروحة (NC_005823) تم الاشتباه في أنه تم التعليق عليها بشكل غير صحيح في ملفات GenBank الخاصة بهم لأن نهاياتهم 3 & rsquo لا تتضمن عزر CCUCC الأساسي. تم تأكيد التعليق التوضيحي الخاطئ من خلال تحليل بيانات RNA-Seq [21]. بالإضافة إلى ذلك ، قد يكون تجمع الرنا الريباسي 16S في الخلية غير متجانس بسبب تدهور الحمض النووي الريبي التفاضلي ، وبالتالي لا ينبغي تمثيله بتسلسل واحد.

الأساس المنطقي لتوصيف 3 و rsquo نهاية 16S rRNA بواسطة بيانات RNA-Seq واضح ومباشر [21,37] ، ويتم تنفيذ الطريقة في برنامج ARSDA [38] والتي تشمل أيضًا مجموعة متنوعة من الوظائف الأخرى لتحليل بيانات RNA-Seq. يقوم أحدهم بتخطيط قراءة الترنسكريبتوميك على جين الرنا الريباسي 16S ومنطقة المصب على الجينوم ، كما هو موضح في الشكل 2. بعض الأنواع البكتيرية مثل المكورات اللبنية لديك تجمع 16S rRNA متجانس نسبيًا مع معظم أنواع الرنا الريباسي 16S في الخلية المنتهية في نفس الموقع (الشكل 2). في مثل هذه الحالات ، تكون النهاية 3 & rsquo واضحة. ومع ذلك ، فإن بعض الأنواع ، مثل Deinococcus Deserti، تم تعيين القراءات المنتهية في موقعين في الغالب [21]. على سبيل المثال ، بالإضافة إلى عدد كبير من القراءات المعينة المنتهية في الموقع 50 في الشكل 2 ، هناك أيضًا عدد كبير من القراءات المعينة المنتهية في الموقع 53 ، لكن القليل من القراءات المعينة تنتهي عند الموقعين 51 و 52 ، مما يؤدي إلى إنشاء توزيع ثنائي النسق لـ يقرأ المعين على المواقع. تحتوي بعض الأنواع الأخرى على تجمعات من الرنا الريباسي 16S غير المتجانسة [21].

الشكل 2 يميز 3 & rsquo نهاية 16S rRNA في المكورات اللبنية بواسطة بيانات RNA-Seq ، وهو 5 و rsquo. GAU GAUCACCUCCUUUC 3 و rsquo. التسلسل الأعلى هو L. اللاكتيس الجين الرنا الريباسي 16S وتسلسله النهائي ، والتسلسلات الأخرى عبارة عن قراءات نصية تم تعيينها للتسلسل العلوي. مستخرج من الشكل 1 في Silke et al. [37].

بالنظر إلى مجموعات مختلفة من الرنا الريباسي 16S في الأنواع المختلفة ، مع توفر مختلف لـ aSD ، يتوقع المرء أن يتطور استخدام SD والتكيف مع أشكال aSD المتاحة [18]. لا يمهد توصيف 3 & rsquo end of 16S rRNA الطريق لدراسة التطور المشترك بين SD و aSD في الأنواع البكتيرية فحسب ، بل يسهل أيضًا تصميم جينات ترميز بروتين الملتهمة مع بدء الترجمة بكفاءة. ستساهم مثل هذه التطورات البحثية في تصميم أنواع العاثيات ضد مسببات الأمراض البكتيرية عندما تفشل المضادات الحيوية. على سبيل المثال ، مرنا من الجين GP6 في B. الرقيقة لا يمكن أن تشكل phage f29 تفاعلات إقران قاعدة SD / aSD مع ذيل 3 & rsquo بكتريا قولونية 16S rRNA [18] ، ولا يمكن ترجمتها إلى بكتريا قولونية [28]. وبالتالي ، إذا أردنا هندسة phage f29 بكتريا قولونية-مثل البكتيريا المسببة للأمراض شيغيلا الأنواع ، سيتعين علينا تعديل GP6 الجين في phage f29 بحيث يمكن لـ mRNA أن يشكل تفاعل SD / aSD مناسبًا لبدء الترجمة في شيغيلا محيط.

4. SD / aSD الاقتران في جينات Phage يعكس مضيفهم

كما ذكرت من قبل ، لا تمتلك العاثيات آلات الترجمة الخاصة بها لإنتاج البروتين. إن اعتمادهم على آلية الترجمة المضيفة يعني أن جينات الملتهمة يجب أن تطور ميزات تسلسلية تعكس جينات المضيف ، وخاصة المضيف HEGs. أوضح تكيف SD / aSD بين مسببات الأمراض البكتيرية الليسترية المستوحدة (تسلسل الجينوم NC_003210) وجينومه المتسلسلان للعاثية: فج PSA (NC_003291) و فج A511 (NC_009811). L. monocytogenes يشفر 2867 جينًا لترميز البروتين في جينومه ، بينما يشفر العاثيات PSA و A511 59 و 199 جينة ترميز البروتين ، على التوالي.

3 و rsquo نهاية 16S rRNA في شرح L. monocytogenes تبين أن الجينوم هو نفسه الذي يتميز به RNA-Seq ، كما هو موضح في المنطقة المظللة في الشكل 3 أ. مع هذه النهاية 3 & rsquo ، يكون توزيع دللبدأ بالنسبة للجينات 2867 لترميز البروتين في L. monocytogenes مقيدة في نطاق 15-21 ، مع الذروة عند 17 (الشكل 3 ب). وبالمثل ، فإن توزيع دللبدأ من 258 جينًا من الجينات الملتهمة (59 جينًا من Phage PSA و 199 جينًا من فج A511) محصورة فعليًا داخل نفس النطاق ونفس الذروة عند 17 (الشكل 3 ب).يكون منحنى التوزيع للعاثية (الخط الأزرق في الشكل 3 ب) أقل سلاسة من ذلك الخاص بالجينات المضيفة (الخط الأحمر في الشكل 3 ب) ، وهو أمر متوقع نظرًا للعدد الكبير من جينات المضيف والعدد الصغير نسبيًا من جينات الملتهمة.

يشير الشكل 3 ب إلى أنه إذا أردنا تطوير العاثية ضدها L. monocytogenes ، ثم يجب علينا تصميم SD بطريقة تجعل Dللبدأ يجب أن يكون 17. ومع ذلك ، فإن مثل هذا التنبؤ النظري أصبح متاحًا مؤخرًا فقط مع التوصيف الدقيق لمجموعة الرنا الريباسي 16S في الخلية المضيفة. كان هناك القليل من التحقق التجريبي من صحة التنبؤ. بالإضافة إلى ذلك ، بالنسبة للمضيفات البكتيرية ذات تجمع الرنا الريباسي 16S غير المتجانسة ، سيكون التنبؤ أقل وضوحًا ، وسنحتاج إلى توصيف HEGs ومقارنة SDs الخاصة بهم مع تلك الخاصة بـ LEGs لاشتقاق D الأمثلللبدأ.

الشكل 3 اقتران SD / aSD في جينات ترميز البروتين لاثنتين من Listeria phages يعكس مضيفهما ، الليسترية المستوحدة. (أ) تحديد 3 و rsquo نهاية 16S rRNA (تسلسل مظلل) في L. monocytogenes ، مع كون المحور Y هو عدد القراءات النصية التي تم تعيينها للتسلسل الجيني الذي يحيط بعزر CCUCC الأساسي. تمثل النقاط عدد القراءات النصية المعينة التي تنتهي بالتسلسل الموضح في المحور X. بشكل فعال لا يقرأ الخريطة خارج التسلسل المظلل ، مما يشير إلى النهاية 3 & rsquo لـ 16S rRNA. (ب) توزيع دللبدأ لجينات المضيف (الخط الأحمر) ولجينات الملتهمة (الخط الأسود). هذا الأخير أقل سلاسة بسبب وجود عدد أقل من الجينات في العاثيات (إجمالي 258 جينًا في جينوم العاثيات) مقارنة بالمضيف (2867 جينًا في جينوم المضيف NC_003210).

5. الهيكل الثانوي لـ mRNA وكفاءة بدء الترجمة

يمكن للبنية الثانوية أن تزيد أو تقلل من كفاءة بدء الترجمة [4,39,40] ، اعتمادًا على مكان وجود الهيكل الثانوي. إذا تم تضمين كودون البدء في بنية ثانوية مستقرة ، فلن يكون الوصول إليه متاحًا وستظل إشارته محجوبة. ثبت بشكل تجريبي أن البنية الثانوية المستقرة في التسلسلات التي تحيط بكودون البدء تمنع بدء الترجمة [40] ، و mRNAs في الأنواع البكتيرية وحقيقيات النوى أحادية الخلية تميل إلى امتلاك بنية ثانوية أضعف بكثير بالقرب من كودون البداية مقارنة بأي مكان آخر ، خاصة تلك من الجينات المعبر عنها بشكل كبير كما هو موضح في الشكل 8-6 في [19].

لدى Messenger RNAs في كل من العاثيات ومضيفاتها البكتيرية إشارات بدء الترجمة في شكل SD وبدء كودون. إشارات بدء الترجمة هذه في mRNA ، عندما تكون مدمجة في بنية ثانوية ، قد تصبح محجوبة وغير متاحة لمفكك تشفير الإشارة الخاص بها. إذا تم تضمين SD أو كود البدء في بنية ثانوية مستقرة ، فلن يكون متاحًا لفك التشفير بواسطة aSD وبدء الحمض الريبي النووي النقال ، على التوالي. المثال الكلاسيكي هو رمز البدء AUG في الجين المتماثل للعاثية MS2 ، والذي يتم تضمينه في جذع يتكون من جزء من الجين المتماثل وجين الغلاف المنبع. عندما يتم ترجمة جينات الغلاف العلوي ، وفصل البنية الثانوية كنتيجة لذلك ، يتم بعد ذلك ترجمة الجين المتماثل في اتجاه التيار [41]. ومع ذلك ، يمكن للمرء الاستفادة من هذا وتصميم جينات بروتين الملتهمة بطريقة لا يتم إنتاج البروتينات إلا عندما يكون المضيف مصابًا بالحمى ، عن طريق تضمين SD أو بدء الكودون في بنية ثانوية من شأنها أن تذوب عندما ترتفع درجة حرارة الجسم المضيف. ومع ذلك ، يمكن أن تحدث الحمى بسبب مجموعة متنوعة من العوامل التي لا تنطوي على مسببات الأمراض البكتيرية ، لذلك لا يمكن استخدام تنظيم الترجمة بوساطة درجة الحرارة هذا إلا كآلية آمنة من الفشل. هناك حاجة إلى تبديل جيني آخر خاص بالعوامل الممرضة لتحقيق الخصوصية. قدمت الطبيعة العديد من المفاتيح الجينية التي اشتهرت في Phage Lambda [42] ، والبكتيريا مثل أوبيرون لاك [43] وخمائر مثل IRE1-HAC1 التبديل السيطرة على استجابة البروتين غير المطوية [44]. يعتمد التصميم الأمثل للعاقمات المضادة للبكتيريا في النهاية على فهمنا لهذه المفاتيح الجينية ، خاصة تلك التي تستجيب للعدوى البكتيرية. غالبًا ما يتم استخدام الحد الأدنى من الطاقة الحرة (MFE) لقياس ثبات البنية الثانوية ، حيث يشير الصفر إلى عدم وجود بنية ثانوية ويشير المزيد من القيم السلبية إلى بنية ثانوية أقوى. يتم تنفيذ حساب MFE في مكتبة فيينا RNA القابلة للطي [45] ، والتي تُستخدم أيضًا في برنامج DAMBE [20,46] لحساب MFE. تم استخدام هذه الوظيفة في DAMBE ليس فقط لدراسة البنية الثانوية وترجمة جينات الملتهمة [4] ، ولكن أيضًا في جينات الميتوكوندريا [47] وكذلك دخول الريبوسوم الداخلي في الخميرة ، خميرة الخميرة ، وذبابة الفاكهة ، ذبابة الفاكهة سوداء البطن [48]. لوحظ انخفاض ثابت في استقرار البنية الثانوية بالقرب من موقع بدء الترجمة ، والذي تم قياسه بواسطة MFE ، في جميع هذه الحالات ، مما يشير إلى أهمية عدم تضمين إشارة بدء الترجمة داخل بنية ثانوية مستقرة. الهيكل الثانوي أيضًا ضعيف في التسلسلات المصاحبة لكودونات التوقف [20]. لاحظ أن MFE الأكثر سلبية يتوافق مع بنية ثانوية أقوى.

انخفاض كبير في ثبات البنية الثانوية في التسلسلات التي تحيط بكودون البدء في سالبة الجرام بكتريا قولونية تم عرضه مسبقًا [49]. أقدم هنا مزيدًا من التفاصيل عن طريق فصل الجينات إلى جينات عالية ومنخفضة التعبير (HEG و LEG بالإضافة إلى الجينات الخادعة في بكتريا قولونية (الشكل 4 أ) ، وإضافة الموجب الجرام العصوية الرقيقة (الشكل 4 ب). النوعان متباعدان للغاية من الناحية التطورية ، لكن كلاهما يظهر انخفاضًا ثابتًا ومثيرًا في البنية الثانوية في التسلسلات التي تحيط بكودون البداية. على وجه الخصوص ، يكون النمط أكثر وضوحًا في HEGs منه في LEGs (الشكل 4) ، حيث يكون HEGs 200 جين مع أعلى مستوى ITE (فهرس استطالة الترجمة) قيم [6] و LEGs هي 200 جين مع أدنى مستوى ITE القيم. يُظهر ترتيب الجينات مع وفرة البروتين نفس النمط. الجينات الكاذبة المشروحة في بكتريا قولونية يعرض الجينوم أضعف نمط (الشكل 4 أ). تشير هذه النتائج إلى أن البنية الثانوية الضعيفة في التسلسلات التي تحيط بكودون البدء يتم الحفاظ عليها عن طريق الاختيار.

الشكل 4 متوسط ​​MFE (الحد الأدنى من طاقة الطي) لنافذة منزلقة 40 nt ، بحجم خطوة 10 nt ، على طول تسلسلات mRNA بالإضافة إلى 100 nt upstream (على سبيل المثال ، النافذة 1 تمتد من 1 إلى 40 ، النافذة 2 تمتد من 11 إلى 50 ، و هكذا). يقع كود البدء عند 101-103 في المحور السيني. (أ) الإشريكية القولونية K12 MG1665 (NC_000913) ، (ب) العصوية الرقيقة (NC_000964). محسوبة مع DAMBE [46]. يتناقص استقرار البنية الثانوية حيث يصبح MFE أقل سلبية. HEG: 200 جين معبر للغاية LEG: 200 جين معبر بشكل ضعيف.

هل تظهر جينات الملتهمة نفس النمط لانخفاض استقرار البنية الثانوية في التسلسلات التي تحيط بكودون البداية؟ الإجابة هي نعم بشكل عام ، لكنني سأوضحها هنا فقط مع العامل الممرض البكتيري الليسترية المستوحدة واثنين من العاثيات (تم ذكر أرقام انضمام GenBank وعدد الجينات لكل جينوم سابقًا). HEGs في L. monocytogenes تُظهر انخفاضًا أكثر دراماتيكية في البنية الثانوية في التسلسلات التي تحيط بكودون البداية أكثر من LEGs (الشكل 5 أ) ، وهو ما يتوافق مع النمط الوارد في الشكل 4. ما هو جدير بالملاحظة هو أن الليستريا تظهر جينات الملتهمة نفس النمط تمامًا ، مع انخفاض كبير في استقرار الهيكل الثانوي في التسلسلات التي تحيط بكودون البدء (الشكل 5 ب). على وجه الخصوص ، يكون النمط أقوى بكثير في HEGs منه في LEGs (الشكل 5B). وهكذا ، تحاكي جينات الملتهمة الجين المضيف ليس فقط في تفاعل SD / aSD ، ولكن أيضًا في البنية الثانوية في التسلسلات التي تحيط بكودون البدء. بعبارة أخرى ، تطورت كل من جينات الملتهمة و HEGs المضيفة وتكيفت مع نفس آلية ترجمة المضيف واكتسبت تفاعل SD / aSD مماثل واستقرار البنية الثانوية. يسلط هذا الضوء على أهمية دراسة آلية الترجمة المضيفة لفهم تحسين ترجمة phage mRNA. تشير النتائج في الشكل 5 إلى أنه يجب علينا تقليل البنية الثانوية في تصميم جينات الملتهمة لتسهيل بدء الترجمة.

الشكل 5 متوسط ​​MFE (الحد الأدنى من طاقة الطي) للنوافذ المنزلقة على طول تسلسلات mRNA ، بالإضافة إلى 100 nt upstream. حجم النافذة هو 40 وحجم الخطوة 10. يتوافق كود البدء مع المواضع 101-103 على المحور X. (أ) توزيع MFE لـ 200 HEGs (الجينات المعبر عنها بشدة) و 200 LEGs (الجينات المعبر عنها بشكل منخفض) في الليسترية المستوحدة (ب) توزيع MFE في 100 HEGs و 100 LEGs في الليستريا العاثيات PSA و A511 (بإجمالي 258 جينًا). جتم حذفه مع DAMBE [46]. يتناقص استقرار البنية الثانوية حيث يصبح MFE أقل سلبية. HEG: جينات معبرة عالية LEG: جينات معبر عنها بشكل ضعيف. تم إنشاء العلاقة من DAMBE.

بدأت العديد من الجينومات البكتيرية والعاثية في كودون إيقاف تداخل كودون ، على سبيل المثال ، في تكوينات UAAUG (حيث AUG هو كودون البدء للجين المصب و UAA كود الإيقاف للجين المنبع) و AUGA (حيث AUG هو كود البداية لـ الجين المصب و UGA كود الإيقاف للجين المنبع). بالنسبة لمثل هذه الجينات ، ليس من الواضح ما إذا كان التخفيض في البنية الثانوية هو لتسهيل فك كودون البدء أو كود الإيقاف. لتجنب هذا التعقيد ، يتم إنشاء الشكل 4 والشكل 5 من جينات غير متداخلة مع تسلسل جيني لا يقل عن 50 nt. من المهم أخذ هذه الجينات المتداخلة في الاعتبار عند دراسة إشارات البدء أو الإيقاف. على سبيل المثال ، تم توثيق فائض من النيوكليوتيدات U بعد أكواد الإيقاف (+ 4U) في عدد من الدراسات [50,51] ، ويتم تفسيره للمساهمة في قوة إشارة التوقف. ومع ذلك ، قد يكون هذا الفائض من + 4U ناتجًا فقط عن عدد كبير من الجينات بتكوين UAAUG وقد لا علاقة له بالمساهمة في قوة إشارة التوقف.

6. بدء الترجمة وخصوصية مضيف Phage

من المحتمل أن المتطلبات المحددة لـ mRNA (على سبيل المثال ، الموضع الأمثل وتقارب الربط في تفاعل SD / aSD والبنية الثانوية الضعيفة في التسلسلات التي تحيط بكودون البدء) قد تحد من خصوصية مضيف الملتهمة. على سبيل المثال ، نظرًا للاختلاف في 3 و rsquo نهاية 16S rRNA بين الأنواع البكتيرية المختلفة ، قد يفشل phage mRNA الذي يحتوي على تفاعل SD / aSD الأمثل في أحد الأنواع البكتيرية في الحصول على تفاعل SD / aSD جيد في الأنواع البكتيرية الأخرى ، أي ، فج هو يقتصر على السابق كمضيف.

يمكن لبعض الأنواع البكتيرية أن تترجم مجموعة متنوعة من الرسائل ، في حين أن البعض الآخر أكثر تقييدًا. على سبيل المثال، بكتريا قولونية تمتلك آلات ترجمة مسموح بها أكثر من B. الرقيقة، على الأرجح بسبب بروتين الريبوسوم S1 في بكتريا قولونية الذي يسمح بترجمة mRNA مع SD ضعيف أو ضعيف الوضع [27,28]. ومع ذلك ، هناك استثناء واحد نادر [28]. جين 6 (GP6) التابع B. الرقيقة يمكن ترجمة phage f29 بكفاءة إلى B. الرقيقة لكن لا في الإشريكية القولونية. اتضح أنه GP6 هو الجين الوحيد من أصل 16 جينًا متوقعًا في phage f29 الذي لا يمكن أن يشكل SD / aSD في وضع جيد في بكتريا قولونية [18]. فشل gp6 ، وهو أمر ضروري لبقاء العاثيات ، لتشكيل SD / aSD مناسب في بكتريا قولونية يفسر سبب عدم تمكنه من توسيع نطاق مضيفه إلى بكتريا قولونية. أي ، حتى لو حصل على دخول في بكتريا قولونيةعلى غرار المضيف ، لن يكون قادرًا على إنتاج بروتين gp6 الأساسي وبالتالي لن ينجو ويتكاثر بنجاح.

7. تأثير بدء الترجمة على الاستطالة

تمامًا كما يتم التعرف على SD بواسطة aSD ، يتم فك رموز الحس بواسطة الحمض الريبي النووي النقال. أظهرت العديد من الدراسات أن التكيف مع الكودون والمضاد للكودون زاد من كفاءة استطالة الترجمة ، من خلال ربط استخدام الكودون بوفرة الحمض النووي الريبي [52,53,54,55,56,57,58,59] ، باتباع التغيرات التطورية في جينات الحمض الريبي النووي النقال والتغيير المرتبط في استخدام الكودون [60,61] ، من خلال التغيير التجريبي لاستخدام الكودون ومراقبة إنتاج البروتين [62,63,64,65] ، ومن خلال التبرير النظري بالنماذج [1,56,66,67,68]. كما تم إثبات تكيف كودون في [phage] [4,8,69,70] وفي فيروس HIV-1 [71] التي كان يُعتقد في السابق أنها تعرض القليل من التكيف مع الكودون بسبب معدل طفراتها العالية. في هذا السياق ، من المدهش أن نواجه ادعاءًا مدعومًا على ما يبدو بأن كفاءة استطالة الترجمة ليس لها صلة تذكر بمعدل إنتاج البروتين [2].

كودلا وآخرون [2] صمم مكتبة تركيبية تتكون من 154 جينًا ، جميعها تشفر نفس البروتين ولكنها تختلف في درجات تكيف الكودون ، لتقدير تأثير استخدام الكودون التفاضلي على إنتاج البروتين في بكتريا قولونية. وخلصوا إلى أن تحيز ldquocodon لا يرتبط بالتعبير الجيني وأن بدء الترجمة ldquotranslation ، وليس الاستطالة ، يحد من معدل التعبير الجيني. المشكلة الرئيسية للورقة هي أنها لم تأخذ في الاعتبار الاختلافات في بدء الترجمة بين هذه الجينات المهندسة. تصبح كفاءة استطالة الترجمة مهمة وتحد من معدل إنتاج البروتين فقط في mRNAs مع بدء ترجمة عالية. عندما يؤخذ كل من بدء الترجمة واستطالة الترجمة في الاعتبار ، يزداد إنتاج البروتين بشكل كبير مع تكيف الكودون [5,6].

8. الخلاصة

تمثل آلية ترجمة العوائل البكتيرية بيئة تشكل تطور جينات ترميز البروتين من كل من المضيف والعاثية. وبالتالي ، فإن دراسة آلات ترجمة المضيف ستسلط الضوء على الكيفية التي ينبغي أن تتطور بها جينات ترميز البروتين في العاثيات. توضح هذه المراجعة أن جينات الملتهمة تشبه جينات المضيف المعبر عنها بدرجة عالية في كل من إشارات بدء الترجمة والبنية الثانوية الضعيفة في التسلسلات التي تحيط بإشارات البدء.

شكر وتقدير

تم تمويل هذا البحث من قبل Discovery Grant من مجلس أبحاث العلوم الطبيعية والهندسة (NSERC، RGPIN / 2018-03878) في كندا. أشكر J. Silke و Y. Wei على المناقشة والتعليقات.

الكاتب الاشتراكات

قام Xuhua Xia بكل العمل.

تضارب المصالح

أصرح بعدم وجود تضارب في المصالح. لم يكن للممولين أي دور في تصميم الدراسة في جمع البيانات أو تحليلها أو تفسيرها في كتابة المخطوطة ، أو في قرار نشر النتائج.

مراجع

  1. بولمر م. علم الوراثة. 1991 129: 897-907.
  2. كودلا جي ، موراي إيه دبليو ، توليرفي دي ، بلوتكين جي بي. محددات تسلسل الترميز للتعبير الجيني في الإشريكية القولونية. علم. 2009 324: 255-258. [CrossRef]
  3. Liljenstrom H، von Heijne G. تعديل معدل الترجمة عن طريق استخدام الكودون التفضيلي: تأثيرات الموقع داخل الجين. J ثور بيول. 1987124: 43-55. [CrossRef]
  4. Prabhakaran R و Chithambaram S و Xia X. Escherichia coli و Staphylococcus phages: تأثير كفاءة بدء الترجمة على التكيف التفاضلي للكودون بوساطة أنماط الحياة الخبيثة والمعتدلة. ياء الجنرال فيرول. 2015 96: 1169-1179. [CrossRef]
  5. Tuller T و Waldman YY و Kupiec M و Ruppin E. يتم تحديد كفاءة الترجمة من خلال كل من تحيز الكودون والطاقة القابلة للطي. Proc Natl Acad Sci USA. 2010107: 3645-3650. [CrossRef]
  6. شيا X. جدل كبير في التكيف مع كودون أنتيكودون تم حله من خلال مؤشر استخدام كودون جديد. علم الوراثة. 2015199: 573-579. [CrossRef]
  7. Bull JJ ، Badgett MR ، Springman R ، Molineux IJ. خصائص الجينوم وحدود التكيف في العاثيات. تطور. 2004 58: 692-701. [CrossRef]
  8. Chithambaram S ، Prabhakaran R ، Xia X. التكيف التفاضلي للكودون بين لاقمات dsDNA و ssDNA في الإشريكية القولونية. مول بيول إيفول. 2014 31: 1606-1617. [CrossRef]
  9. Shine J ، Dalgarno L. التسلسل 3'-terminal من Escherichia coli 16S ribosomal RNA: التكامل مع ثلاثة توائم هراء ومواقع ربط الريبوسوم. Proc Natl Acad Sci USA. 1974 71: 1342-1346. [CrossRef]
  10. Shine J، Dalgarno L. تسلسل أوكتانوكليوتيد ثلاثي الأطراف متطابق في 18S حمض الريبوسوم الريبوني من حقيقيات النوى المختلفة. دور مقترح لهذا التسلسل في التعرف على أكواد إنهاء. Biochem J. 1974141: 609-615. [CrossRef]
  11. Shine J، Dalgarno L. محدد لخصوصية الكسترون في الريبوسومات البكتيرية. طبيعة سجية. 1975 254: 34-38. [CrossRef]
  12. Steitz JA ، Jakes K. كيف تختار الريبوسومات مناطق البادئ في mRNA: تكوين زوج القاعدة بين الطرف الثالث لـ 16S rRNA و mRNA أثناء بدء تخليق البروتين في الإشريكية القولونية. Proc Natl Acad Sci USA. 1975 72: 4734-4738. [CrossRef]
  13. Taniguchi T، Weissmann C. تثبيط تكوين معقد البدء Qbeta RNA 70S الريبوسوم بواسطة قليل النوكليوتيد المكمل للمنطقة الطرفية 3 'من E. coli 16S ribosomal RNA. طبيعة سجية. 1978275: 770-772. [CrossRef]
  14. Kozak M. آلية التعرف على الرنا المرسال بواسطة الريبوسومات حقيقية النواة أثناء بدء تخليق البروتين. كور أعلى ميكروبيول إمونول. 1981 93: 81-123. [CrossRef]
  15. Kozak M. الدور المحتمل للنيوكليوتيدات المرافقة في التعرف على كودون البادئ AUG بواسطة الريبوسومات حقيقية النواة. الدقة الأحماض النووية. 1981 9: 5233-5252. [CrossRef]
  16. Xia X. موقع + 4G في إجماع Kozak لا علاقة له بكفاءة بدء الترجمة. بلوس واحد. 2007 2: e188. [CrossRef]
  17. هوى أ ، دي بوير ها. نظام الريبوسوم المتخصص: الترجمة التفضيلية لنوع واحد من الرنا المرسال بواسطة مجموعة سكانية فرعية من الريبوسومات المتحولة في الإشريكية القولونية. Proc Natl Acad Sci USA. 1987 84: 4762-4766. [CrossRef]
  18. Abolbaghaei A ، Silke JR ، Xia X. كيف يمكن للتغييرات في التسلسلات المضادة لـ SD أن تؤثر على متواليات SD في الإشريكية القولونية و Bacillus subtilis. G3. 2017 7: 1607-1615. [CrossRef]
  19. Xia X. المعلوماتية الحيوية وبدء الترجمة. المعلوماتية الحيوية والخلية: الأساليب الحسابية الحديثة في علم الجينوم والبروتينات وعلم النسخ. سبرينغر ، شام 2018. ص. 173-195. [CrossRef]
  20. Xia X. DAMBE6: أدوات جديدة لعلم الجينوم الميكروبي وعلم الوراثة والتطور الجزيئي. J Hered. 2017108: 431-437. [CrossRef]
  21. Wei Y و Silke JR و Xia X. توضيح حدود 16S rRNA 3 وتحديد الاقتران الأمثل SD / aSD في Escherichia coli و Bacillus subtilis باستخدام بيانات RNA-Seq. ممثل العلوم. 2017 7: 17639. [CrossRef]
  22. شيا العاشر المعلوماتية الحيوية واستطالة الترجمة. المعلوماتية الحيوية والخلية: الأساليب الحسابية الحديثة في علم الجينوم والبروتينات وعلم النسخ. سبرينغر ، شام 2018. ص. 197-238. [CrossRef]
  23. Melancon P، Leclerc D، Destroismaisons N، Brakier-Gingras L. منطقة مكافحة اللمعان Dalgarno في Escherichia coli 16S ribosomal RNA ليست ضرورية للاختيار الصحيح لبدايات الترجمة. الكيمياء الحيوية. 1990 29: 3402-3407. [CrossRef]
  24. Sartorius-Neef S ، Pfeifer F. دراسات في الجسم الحي على متواليات مفترضة Shine-Dalgarno من الملوحة الآثارية Halobacterium salinarum. مول ميكروبيول. 2004 51: 579-588. [CrossRef]
  25. ناكاموتو ت.نظرة موحدة لبدء تخليق البروتين. Biochem Biophys Res Commun. 2006 341: 675-678. [CrossRef]
  26. Sprengart ML، Fuchs E، Porter AG. صندوق المصب: إشارة بدء ترجمة فعالة ومستقلة في الإشريكية القولونية. Embo J. 1996 15: 665-674. [CrossRef]
  27. Duval M ، Korepanov A ، Fuchsbauer O ، Fechter P ، Haller A ، Fabbretti A ، et al.يتكشف بروتين ريبوسوم الإشريكية القولونية S1 جزيئات الرنا المرسال المهيكلة على الريبوسوم لبدء الترجمة النشطة. بلوس بيول. 2013 11: e1001731. [CrossRef]
  28. Vellanoweth RL، Rabinowitz JC. تأثير عناصر موقع ربط الريبوسوم على الكفاءة الانتقالية في Bacillus subtilis و Escherichia coli في الجسم الحي. مول ميكروبيول. 1992 6: 1105-1114. [CrossRef]
  29. Sulthana S ، دويتشر MP. تحفز نوكليازات exoribonucleases المتعددة نضوج الطرف الثالث لـ 16S الريبوسوم RNA (الرنا الريباسي). J بيول كيم. 2013 288: 12574-12579. [CrossRef]
  30. دويتشر ام بي. عشرين عامًا من معالجة RNases و RNA البكتيرية: كيف نضجنا. RNA. 2015 21: 597-600. [CrossRef]
  31. Woese CR و Magrum LJ و Gupta R و Siegel RB و Stahl DA و Kop J وآخرون. نموذج الهيكل الثانوي للحمض النووي الريبي الريبوزومي 16S البكتيري: دليل التطور ، الأنزيمية والكيميائية. الدقة الأحماض النووية. 1980 8: 2275-2293. [CrossRef]
  32. لين YH ، تشانغ قبل الميلاد ، شيانغ بي دبليو ، تانغ سي. شروح الجين الريبوسومي 16S المشكوك فيها متكررة في الجينومات الميكروبية المكتملة. الجين. 2008 416: 44-47. [CrossRef]
  33. ناكاجاوا S ، Niimura Y ، Miura K ، Gojobori T. التطور الديناميكي لآليات بدء الترجمة في بدائيات النوى. Proc Natl Acad Sci USA. 2010107: 6382-6387. [CrossRef]
  34. Starmer J ، Stomp A ، Vouk M ، Bitzer D. توقع مواقع تسلسل Shine-Dalgarno يكشف أخطاء شرح الجينوم. بلوس كومبوت بيول. 2006 2: e57. [CrossRef]
  35. Jones CE ، Brown AL ، Baumann U. تقدير معدل خطأ التعليق التوضيحي لتعليقات تسلسل قاعدة بيانات GO المنسقة. المعلوماتية الحيوية BMC. 2007 8: 170. [CrossRef]
  36. Lagesen K ، Hallin P ، Rodland EA ، Staerfeldt HH ، Rognes T ، Ussery DW. RNAmmer: شرح متسق وسريع لجينات RNA الريبوسوم. الدقة الأحماض النووية. 2007 35: 3100-3108. [CrossRef]
  37. Silke JR ، Wei Y ، Xia X. التحليل القائم على RNA-Seq يكشف عن عدم التجانس في نهاية 16S rRNA 3 الناضجة وزخارف دالغارنو المضادة للتألق في الأنواع البكتيرية. G3. 2018 8: 3973-3979. [CrossRef]
  38. Xia X. ARSDA: نهج جديد لتخزين ونقل وتحليل البيانات النصية. G3. 2017 7: 3839-3848. [CrossRef]
  39. Kozak M. تأثير البنية الثانوية لـ mRNA على الارتباط والهجرة للوحدات الفرعية الريبوسومية 40S. زنزانة. 1980 19: 79-90. [CrossRef]
  40. Osterman IA ، Evfratov SA ، Sergiev PV ، Dontsova OA. مقارنة بين ميزات mRNA التي تؤثر على بدء الترجمة وإعادة التهيئة. الدقة الأحماض النووية. 2013 41: 474-486. [CrossRef]
  41. Jou WM ، Haegeman G ، Ysebaert M ، Fiers W. تسلسل النوكليوتيدات للترميز الجيني لبروتين غلاف MS2 للعاثيات. طبيعة سجية. 1972237: 82-88. [CrossRef]
  42. Ptashne M. مفتاح جيني: إعادة النظر في Phage lambda. الطبعة الثالثة. كامبريدج ، ماساتشوستس: Cell Press and Blackwell Scientific 2004. 154 ص.
  43. جاكوب ف ، مونود جيه. الآليات التنظيمية الجينية في تخليق البروتينات. J مول بيول. 1961 3: 318-356. [CrossRef]
  44. Xia X. التحكم في ترجمة HAC1 عن طريق تنظيم التضفير في Saccharomyces cerevisiae. المجلة الدولية للعلوم الجزيئية. 2019 20: 2860. [CrossRef]
  45. Hofacker IL. خادم البنية الثانوية للجيش الملكي النيبالي فيينا. الدقة الأحماض النووية. 2003 31: 3429-3431. [CrossRef]
  46. Xia X. DAMBE7: أدوات جديدة ومحسنة لتحليل البيانات في علم الأحياء الجزيئي والتطور. مول بيول إيفول. 2018 35: 1550-1552. [CrossRef]
  47. Zid BM و Rogers AN و Katewa SD و Vargas MA و Kolipinski MC و Lu TA وآخرون. يطيل 4E-BP العمر الافتراضي عند التقييد الغذائي عن طريق تعزيز نشاط الميتوكوندريا في ذبابة الفاكهة. زنزانة. 2009 139: 149-160. [CrossRef]
  48. شيا X ، هولسيك م. إن IRESs قوية حقيقية النواة لها بنية ثانوية ضعيفة. بلوس واحد. 2009 4: e4136. [CrossRef]
  49. شيا العاشر المعلوماتية الحيوية وإنهاء الترجمة في البكتيريا. المعلوماتية الحيوية والخلية: الأساليب الحسابية الحديثة في علم الجينوم والبروتينات وعلم النسخ. سبرينغر ، شام 2018. ص. 239-254. [CrossRef]
  50. Wei Y، Xia X. دور + 4U كإشارة إنهاء ترجمة ممتدة في البكتيريا. علم الوراثة. 2017205: 539-549. [CrossRef]
  51. Wei Y و Wang J و Xia X. التطور المشترك بين إيقاف استخدام الكودون وعوامل الإطلاق في الأنواع البكتيرية. مول بيول إيفول. 2016 33: 2357-2367. [CrossRef]
  52. Ikemura T. الارتباط بين وفرة RNAs لنقل الإشريكية القولونية وحدوث الكودونات ذات الصلة في جينات البروتين الخاصة بها: اقتراح لاختيار كودون مرادف هو الأمثل لنظام E coli متعدية. J مول بيول. 1981 151: 389-409. [CrossRef]
  53. Ikemura T. الارتباط بين وفرة RNAs لنقل الإشريكية القولونية وحدوث الكودونات ذات الصلة في جينات البروتين الخاصة بها. J مول بيول. 1981 146: 1-21. [CrossRef]
  54. Ikemura T. العلاقة بين وفرة RNAs لنقل الخميرة وحدوث الكودونات ذات الصلة في جينات البروتين. الاختلافات في أنماط اختيار الكودون المترادفة للخميرة والإشريكية القولونية مع الإشارة إلى وفرة RNAs التي تقبل النقل. J مول بيول. 1982158: 573-597. [CrossRef]
  55. Ikemura T. الارتباط بين استخدام الكودون ومحتوى الحمض الريبي النووي النقال في الكائنات الحية الدقيقة. في: نقل الحمض النووي الريبي في تخليق البروتين. بوكا راتون: مطبعة CRC 1992. ص. 87-111. [CrossRef]
  56. Xia X. ما مدى تحسين آلية الترجمة في Escherichia coli و Salmonella typhimurium و Saccharomyces cerevisiae؟ علم الوراثة. 1998149: 37-44.
  57. Carullo M، Xia X. دراسة مستفيضة للطفرة والاختيار على النيوكليوتيدات المتذبذبة في مضادات الكودونات tRNA في جينومات الميتوكوندريا الفطرية. J مول إيفول. 2008 66: 484-493. [CrossRef]
  58. Xia X. طفرة وانتقاء على anticodon من جينات tRNA في جينومات الميتوكوندريا الفقارية. الجين. 2005 345: 13-20. [CrossRef]
  59. Wei Y و Silke JR و Xia X. تقدير محسّن لتعبير الحمض النووي الريبي لتوضيح التطور المشترك بين وفرة الحمض النووي الريبي واستخدام الكودون في البكتيريا. ممثل العلوم .2019 9: 3184. [CrossRef]
  60. شيا العاشر التطور السريع للميتوكوندريا الحيوانية. في: التطور في الخط السريع: الجينات والأنظمة الجينية سريعة التطور. أكسفورد: مطبعة جامعة أكسفورد 2012. ص. 73-82 [كروسريف]
  61. Xia X ، و Huang H ، و Carullo M ، و Betran E ، و Moriyama EN. الصراع بين بدء الترجمة والاستطالة في جينومات الميتوكوندريا الفقارية. بلوس واحد. 2007 2: e227. [CrossRef]
  62. Robinson M و Lilley R و Little S و Emtage JS و Yarranton G و Stephens P وآخرون. يمكن أن يؤثر استخدام الكودون على كفاءة ترجمة الجينات في الإشريكية القولونية. الدقة الأحماض النووية. 1984 12: 6663-6671. [CrossRef]
  63. Sorensen MA، Kurland CG، Pedersen S. Codon يحدد استخدام معدل الترجمة في الإشريكية القولونية. J مول بيول. 1989207: 365-377. [CrossRef]
  64. Ngumbela KC و Ryan KP و Sivamurthy R و Brockman MA و Gandhi RT و Bhardwaj N وآخرون. التأثير الكمي لاستخدام الكودون دون الأمثل على الكفاءة متعدية لـ mRNA ترميز هفوة HIV-1 في الخلايا التائية السليمة. بلوس واحد. 2008 3: e2356. [CrossRef]
  65. Haas J ، Park E-C ، Seed B. حدود استخدام Codon في التعبير عن بروتين سكري مغلف HIV-1. كور بيول. 1996 6: 315-324. [CrossRef]
  66. بولمر م. تأثير السياق على استخدام الكودون المرادف في الجينات ذات التحيز المنخفض لاستخدام الكودون. الدقة الأحماض النووية. 1990 18: 2869-2873. [CrossRef]
  67. Palidwor GA ، Perkins TJ ، Xia X. نموذج عام لتحيز الكودون بسبب التحيز الطفري في GC. بلوس واحد. 2010 5: e13431. [CrossRef]
  68. Xia X. تكلفة الترجمة المتذبذبة في جينومات الميتوكوندريا الفطرية: تكامل فرضيتين تقليديتين. بي إم سي إيفول بيول. 2008 8: 211. [CrossRef]
  69. Prabhakaran R و Chithambaram S و Xia X. تقوم عاثيات Aeromonas بترميز الحمض الريبي النووي النقال لرموزها المفرطة الاستخدام. Int ياء كومبوت بيول المخدرات ديس. 2014 7: 168-182. [CrossRef]
  70. Chithambaram S، Prabhakaran R، Xia X. تأثير الطفرة والاختيار على تكيف الكودون في بكتيريا الإشريكية القولونية. علم الوراثة. 2014197: 301-315. [CrossRef]
  71. van Weringh A و Ragonnet-Cronin M و Pranckeviciene E و Pavon-Eternod M و Kleiman L و Xia X. يعدل HIV-1 تجمع الحمض الريبي النووي النقال لتحسين كفاءة الترجمة. مول بيول إيفول. 2011 28: 1827-1834. [CrossRef]

لتلقي جدول محتويات الإصدارات التي تم إصدارها حديثًا من علم الوراثة OBM، أضف عنوان بريدك الإلكتروني في المربع أدناه ، وانقر فوق اشتراك.


مناقشة

أظهرت دراستنا أن اثنين من HoxA mRNAs ، هوكسا 3 و هوكسا 11، يتم تنظيمها من خلال آليات مختلفة لضمان تثبيط الترجمة المعتمدة على الغطاء والسماح لنا باقتراح نموذجين متميزين لطريقة عملهم (الشكل 8). أولاً ، أظهرنا أن TIEs يمكن أن تعمل في المختبر باستخدام مقتطفات الترجمة الخالية من الخلايا. ثم أكدنا النتائج التي تم الحصول عليها بهذه المقتطفات باستخدام المقايسات في الجسم الحي في العديد من خطوط الخلايا. النتائج التي توصلنا إليها تشير إلى ذلك هوكسا 3 يمنع الترجمة عن طريق uORF والذي يتم ترجمته من خلال 5’UTR بالكامل هوكسا 3 mRNA ينتج بروتين صغير بحجم 9 KDa. ومن المثير للاهتمام أن محاذاة هوكسا 3 يوضح TIE الحفاظ على uAUG111 (مظلل في المربع الأحمر) بين الأنواع المختلفة. على النقيض من توطين uAUG الذي يتم الحفاظ عليه بشكل كبير ، لا يتم حفظ تسلسل تشفير uORF بين الأنواع (الشكل 8 - ملحق الشكل 1A). في الواقع ، تم التعرف على uORFs كمنظمين للترجمة لعدد من mRNAs الخلوية (Barbosa et al. ، 2013). على سبيل المثال ، أربعة uORFs في 5 'زعيم الخميرة GCN4 mRNA يقيد تدفق مسح الريبوسومات من موقع الغطاء إلى GCN4 رمز البدء (Dever et al. ، 2016 Hinnebusch ، 1993). في النباتات ، فإن uORF في AdoMetDC يولد mRNA سداسي ببتيد ناشئ يتفاعل مع الريبوسوم المترجم لقمع ترجمة AdoMetDC الحمض النووي الريبي بطريقة خاصة بالخلية (Uchiyama-Kadokura et al. ، 2014). ومن المثير للاهتمام أن بياناتنا تشير إلى أن eIF2D مطلوب في هوكسا 3 طريقة عمل TIE (الشكل 6 و 7 أ). أظهرت دراسة حديثة ذلك ذبابة الفاكهة يتم إحداث ترجمة ATF4 mRNA بواسطة eIF2D ومماثله DENR أثناء الاستجابة المتكاملة للضغط (Vasudevan et al. ، 2020). في هذه الحالة ، تتطلب eIF2D فكرة ربط الحمض النووي الريبي الخاص بها للتوسط في ترجمة ATF4 mRNA من خلال تسلسلها الرئيسي 5 بوصات الذي يتكون من uORFs متعددة (Vasudevan et al. ، 2020). علاوة على ذلك ، فقد ثبت أن فسفرة eIF2α خلال مراحل التطور الجنيني تعزز الترجمة من uORFs (Friend et al. ، 2015). لذلك ، فإن بدء الترجمة المعتمدة على الغطاء الكنسي باستخدام eIF2 غير ممكن أثناء التطور الجنيني. بدء الترجمة المعتمدة على الغطاء من uORF من هوكسا 3 قد تستخدم TIE eIF2D كبديل لاستبدال eIF2 الفسفوري غير النشط لتعزيز ترجمة uORF. حتى الآن ، الوحيد رابطة الدول المستقلة-تسلسل الفعل الذي تم تحديده بوضوح على mRNA لتوظيف eIF2D محدد هو نموذج غني بـ A منبع لكودون البدء (Dmitriev et al. ، 2010). أظهرنا ذلك هوكسا 3 يحتوي TIE على مثل هذا A-motif المنبع من uORF وهو أمر بالغ الأهمية لوظيفة TIE (الشكل 7). أظهرت تقارير أخرى أن eIF2D سيشكل مجمعات بدء على 5'UTRs بلا قيادة وغنية (Akulich et al. ، 2016 Dmitriev et al. ، 2010). في هوكسا 3 مكننا تحليل قياس الطيف الكتلي TIE من إثبات أن eIF2D موجود فقط في مجمعات ما قبل البدء المبرمجة باستخدام هوكسا 3 ربطة عنق. الأهم من ذلك ، تم العثور على عاملين آخرين ، eIF5B و HBS1L ، على وجه التحديد في هوكسا 3 المجمعات ، والتي ستكون مثيرة للاهتمام للتحقيق في مشاركتها في آلية تعتمد على eIF2D (الشكل 6). بخصوص هوكسا 11 TIE ، يتعرف الريبوسوم على مزيج من اثنين رابطة الدول المستقلة-تصرف العناصر في 5’UTR (الشكل 8). (1) مجموعة كودون بدء-توقف تقع في المواضع 84-89 و (2) بنية حلزونية (SL) طويلة وثابتة عالية الاستقرار تقع عند +20 أسفل المصب من uAUG (حسب الاتفاقية ، يكون A من AUG + 1). يعمل هذان العنصران في تآزر لتعزيز توقف مجمع 80S المنبع من SL. هذا يذكرنا بآلية مماثلة تم وصفها في نبات الأرابيدوبسيس thaliana NIP5.1 5’UTR mRNA الذي يحتوي على AUG-stop الذي ينظم ترجمة ORF الرئيسي من خلال آلية توقف الريبوسوم وتدهور mRNA (Tanaka et al. ، 2016). تتطلب هذه الآلية فقط أكواد البداية والتوقف. في حالة هوكسا 11 يلعب TIE ، هيكل SL المستقر الموجود في اتجاه المصب من AUG-stop دورًا رئيسيًا. إن الريبوسوم المتوقف مع كودون الإيقاف في الموقع A ، وبعبارة أخرى موقع A فارغ بدون أي الحمض الريبي النووي النقال ، عادة ما يكون إشارة لتجنيد عوامل الإطلاق لفصل الوحدات الفرعية الريبوسومية عن الرنا المرسال. من خلال اختبار الترجمة الخالية من الخلايا وتحليل تدرج السكروز ، أظهرنا أن 80S المتوقفة مبرمجة باستخدام هوكسا 11 TIE مستقر جدًا ولا ينفصل (الشكل 5C). قد يكون التفسير المحتمل لاستقرار هذا المركب هو أن SL يمنع وصول عوامل الإطلاق إلى موقع A الفارغ وبالتالي يمنع تفكك الريبوسوم (Brown et al. ، 2015). ومن المثير للاهتمام أن محاذاة هوكسا 11 يوضح TIE بين الأنواع المختلفة أن تركيبة البداية والتوقف (المظللة باللون الأحمر) تفتقر إلى الحفظ وتظل خاصة بالأنواع (الشكل 8 - ملحق الشكل 1 ب). تمتلك بعض الأنواع بديلاً لكودون البدء AUG إلى أكواد شبيهة بـ AUG مثل GUG أو طفرة في كودون الإيقاف تؤدي إلى uORF أطول. في المقابل ، لا يزال SL (104-154) محفوظًا بدرجة عالية مما يشير إلى أهميته الوظيفية العالية (الشكل 8 - ملحق الشكل 1B). وفقًا لذلك ، أظهرنا أن SL الوحيد قوي بما يكفي لإعاقة المسح بواسطة مجمع ما قبل البدء. في الواقع ، ثبت أن الهياكل الثانوية في 5’UTR تمنع الترجمة مثل حالة بنية SL المحفوظة في 5’UTR من TGF-β1 mRNA (جينكينز وآخرون ، 2010). لذلك ، في مختلف الأنواع ، هوكسا 11 قد تستخدم TIE مجموعات مختلفة من رابطة الدول المستقلة-تصرف العناصر من أجل منع الترجمة المعتمدة على الأحرف الكبيرة ، الشائعة رابطة الدول المستقلة- عنصر فاعل بين جميع الأنواع هو SL الذي يتم حفظه.

نموذجان متميزان للتثبيط الترجمي بواسطة هوكسا 3 عنصر تثبيط الترجمة (TIE) و هوكسا 11 ربطة عنق.

نموذج ل هوكسا 3 يقترح TIE مجموعة ريبوزومية على uAUG111 مع شرط عامل بدء eIF2D. نموذج هوكسا 11 يقترح TIE وجود ريبوسوم 80S متوقف على مجموعة أكواد AUG-stop المنبع من هيكل مستقر للغاية.

كما هو موضح سابقًا ، فإن ملف هوكسا 11 يتطلب IRES وجود بروتين الريبوسوم RpL38 أثناء هوكسا 3 IRES مستقل عن RpL38 (Kondrashov et al. ، 2011). كشفت تجارب السبر لدينا أن كلاهما قابل للطي هوكسا 3 و هوكسا 11 TIEs مستقلة عن وجود IRES مما يشير إلى أن طريقة عملها لا تعتمد على IRES. قد تكون TIE قد تطورت بهذه الطريقة لتفضيل الترجمة من IRES المتجه نحو المصب ومن ثم يبرر سبب وجود تباين من حيث التسلسل والآلية ولكن نفس التأثير المثبط. هذا المزيج الفريد من مثبط آلية الترجمة المتعارف عليها ومنشط الترجمة المتخصصة يحدد نقطة مثيرة للاهتمام حول كيفية منح عناصر 5’UTR خصوصية الريبوسوم للترجمة (Xue et al.، 2015). الأهم من ذلك ، أن الحصول على TIEs في مجموعات فرعية من Hox mRNAs يتيح طبقة إضافية من التحكم التنظيمي بين الترجمة المتعارف عليها والترجمة المعتمدة على IRES. قد تكون إحدى الدراسات المثيرة للاهتمام هي تحديد كيف تمنع TIEs الأخرى a4 و a9 الترجمة وما إذا كانت هناك ميزات وظيفية مشتركة بين جميع Hox mRNAs. بخلاف Hox mRNAs ، تشير بياناتنا حول eIF2D إلى دور محدد في بدء الترجمة وسيكون من المثير للاهتمام فك شفرة دورها الدقيق على المستوى الجزيئي. بتعبير أدق ، هناك حاجة إلى التحقيقات التي ستسمح بتحديد كيفية تأثير طول uORF وتكوين الكودون وتسلسلات الإجماع على دور eIF2D في عملية البدء على uORFs. ستكون هناك حاجة لدراسات مستقبلية لفهم دور eIF2D تمامًا في بدء ترجمة mRNAs محددة.


مستقبل التعبير عن البروتين

في المستقبل ، من المحتمل أن نرى تطورات في ترجمة cDNA الموجهة للتعبير البروتيني الفعال والمستهدف في أنواع الخلايا المختلفة. هذه التطبيقات مبررة بحقيقة أن الخلايا المتكاثرة وغير المنقسمة من نفس الكائن يمكن أن يكون لها في الواقع أنماط مختلفة لاستخدام الكودون .3 علاوة على ذلك ، فإن استخدام الكودون التفاضلي الظاهر في الخلايا السرطانية مقابل الخلايا الطبيعية يمثل هدفًا علاجيًا جديدًا وجذابًا ، خاصةً بالنسبة للتركيبات. تطبيقات علم الأحياء. على سبيل المثال ، يمكن زيادة التعبير الجيني عن مثبط الورم أو cDNAs المسببة للموت بشكل تفضيلي في الخلايا السرطانية من خلال تحسين تفضيلات الكودون لهذه الخلايا.

ليس هناك شك في أن التقدم في تحسين الكودون لديه القدرة على تحسين إنتاج البروتين المؤتلف بشكل ملحوظ ، والبيولوجيا التركيبية ، وتصميم العلاج المخصص ، بما في ذلك العلاج الجيني واللقاحات القائمة على الحمض النووي. ومع ذلك ، قبل أن تتحقق هذه التطبيقات بالكامل ، هناك حاجة إلى فهم أعمق لتأثيرات تحسين الكودون ، حيث أثيرت عدة مرات المخاوف المحيطة بخطر تطوير الأجسام المضادة المضادة للعقاقير. لا يمكن لمثل هذه التأثيرات غير المرغوبة أن تقلل من فعالية الدواء فحسب ، بل تتسبب أيضًا في تفاعلات مناعية ، مما يهدد سلامة البروتينات العلاجية المحسّنة من الكودون. إذا أمكن تخفيف هذه المخاوف ، فسنكون أقرب من أي وقت مضى إلى عصر جديد من الطب الشخصي.

لمزيد من الأفكار حول ما قد يحمله المستقبل لتعبير البروتين والعلاجات ، ألق نظرة على هذه المراجعة النقدية.


الترجمة والاستطالة والإنهاء

في بدائيات النوى وحقيقيات النوى ، أساسيات الاستطالة هي نفسها ، لذلك سنراجع الاستطالة من منظور بكتريا قولونية. الوحدة الفرعية 50S الريبوسومية من بكتريا قولونية يتكون من ثلاث حجرات: موقع A (aminoacyl) يربط aminoacyl tRNAs المشحونة الواردة. يربط موقع P (peptidyl) tRNAs المشحونة التي تحمل الأحماض الأمينية التي شكلت روابط ببتيدية مع سلسلة polypeptide المتنامية ولكنها لم تنفصل بعد عن tRNA المقابل لها. يقوم موقع E (الخروج) بإطلاق الحمض النووي الريبي المنفصل بحيث يمكن إعادة شحنه بالأحماض الأمينية المجانية. هناك استثناء واحد لخط التجميع هذا من tRNAs: in بكتريا قولونية، [لاتكس] نص-نص^ < نص > _ < text f> [/ latex] قادر على الدخول إلى موقع P مباشرة دون الدخول أولاً إلى الموقع A. وبالمثل ، فإن Met-tRNAi حقيقيات النوى ، بمساعدة البروتينات الأخرى لمجمع البدء ، يرتبط مباشرة بموقع P (الشكل 1). في كلتا الحالتين ، يؤدي هذا إلى إنشاء مجمع بدء مع موقع مجاني جاهز لقبول الحمض الريبي النووي النقال المطابق للكودون الأول بعد AUG.

الشكل 1. ترجمة الريبوسوم مرنا

أثناء استطالة الترجمة ، يوفر قالب mRNA خصوصية. عندما يتحرك الريبوسوم على طول الرنا المرسال ، يتم تسجيل كل كودون مرنا ، ويتم ضمان الارتباط المحدد مع مضاد الكودون المشحون المقابل. إذا لم يكن الرنا المرسال موجودًا في مجمع الاستطالة ، فإن الريبوسوم سيربط الحمض النووي الريبي بشكل غير محدد.

يستمر الاستطالة بدخول الحمض النووي الريبي المشحون إلى الموقع A ثم الانتقال إلى موقع P متبوعًا بالموقع E مع كل كودون مفرد & # 8220 خطوة & # 8221 من الريبوسوم. يتم تحفيز خطوات الريبوسوم عن طريق التغييرات التوافقية التي تقدم الريبوسوم بثلاث قواعد في اتجاه 3.يتم التبرع بالطاقة لكل خطوة من خطوات الريبوسوم بواسطة عامل استطالة يحلل GTP. تتشكل روابط الببتيد بين المجموعة الأمينية للحمض الأميني المرتبط بـ tRNA في الموقع A ومجموعة الكربوكسيل من الحمض الأميني المرتبط بـ الحمض الريبي النووي النقال في موقع P. يتم تحفيز تكوين كل رابطة الببتيد بواسطة بيبتيديل ترانسفيراز، وهو إنزيم قائم على الحمض النووي الريبي (RNA) مدمج في الوحدة الفرعية الريبوزومية 50S. يتم اشتقاق الطاقة لكل تكوين رابطة ببتيد من التحلل المائي GTP ، والذي يتم تحفيزه بواسطة عامل استطالة منفصل. يرتبط الحمض الأميني المرتبط بـ P-site tRNA أيضًا بسلسلة البولي ببتيد المتنامية. عندما يخطو الريبوسوم عبر mRNA ، يدخل الحمض الريبي النووي النقال السابق لموقع P إلى موقع E ، وينفصل عن الحمض الأميني ، ويُطرد (الشكل 2). بشكل مثير للدهشة ، فإن بكتريا قولونية يستغرق جهاز الترجمة 0.05 ثانية فقط لإضافة كل حمض أميني ، مما يعني أنه يمكن ترجمة بروتين مكون من 200 حمض أميني في 10 ثوانٍ فقط.

الشكل 2. تبدأ الترجمة عندما يتعرف البادئ tRNA anticodon على كودون على mRNA. تنضم الوحدة الفرعية الريبوسومية الكبيرة إلى الوحدة الفرعية الصغيرة ، ويتم تجنيد الحمض الريبي النووي النقال الثاني. عندما يتحرك mRNA بالنسبة إلى الريبوسوم ، تتشكل سلسلة البولي ببتيد. يؤدي إدخال عامل التحرير إلى الموقع أ إلى إنهاء الترجمة وتنفصل المكونات.

أسئلة الممارسة

العديد من المضادات الحيوية تمنع تخليق البروتين البكتيري. على سبيل المثال ، يحجب التتراسيكلين الموقع A على الريبوسوم البكتيري ، ويمنع الكلورامفينيكول نقل الببتيدل. ما هو التأثير المحدد الذي تتوقعه لكل من هذه المضادات الحيوية على تخليق البروتين؟

يؤثر التتراسيكلين بشكل مباشر على:

سوف يؤثر الكلورامفينيكول بشكل مباشر

يحدث إنهاء الترجمة عند مصادفة كودون لا معنى له (UAA أو UAG أو UGA). عند المحاذاة مع الموقع A ، يتم التعرف على هذه الأكواد غير المنطقية من خلال عوامل الإطلاق في بدائيات النوى وحقيقيات النوى التي توجه الببتيدل ترانسفيراز لإضافة جزيء ماء إلى نهاية الكربوكسيل للحمض الأميني P-site. يجبر هذا التفاعل الحمض الأميني P-site على الانفصال عن الحمض الريبي النووي النقال الخاص به ، ويتم إطلاق البروتين المصنوع حديثًا. تنفصل الوحدات الفرعية الريبوسومية الصغيرة والكبيرة عن الرنا المرسال ويتم تجنيدها عن بعضها على الفور تقريبًا في مجمع بدء ترجمة آخر. بعد اكتمال ترجمة العديد من الريبوسومات ، يتحلل الرنا المرسال بحيث يمكن إعادة استخدام النيوكليوتيدات في تفاعل نسخ آخر.


المواد التكميلية الإلكترونية

ملف إضافي 1: تسلسل TIRs المستخدمة في الدراسة. يتم توفير تسلسل TIRs. (DOC 32 كيلوبايت)

12867_2007_237_MOESM2_ESM.doc

ملف إضافي 2: النسخ العكسي PCR في الوقت الحقيقي لتحديد مستويات mRNA. يحتوي الملف على معلومات حول مستويات mRNA. (DOC 28 كيلوبايت)

12867_2007_237_MOESM3_ESM.doc

ملف إضافي 3: تأثير TIR على توليف GFP عند 37 درجة مئوية. يتم توفير البيانات التجريبية المستخدمة في الشكل 2 في وحدات التألق. بالإضافة إلى ذلك ، فإن البيانات الخاصة بـ اراباد المروج تظهر. (DOC 304 كيلوبايت)

12867_2007_237_MOESM4_ESM.doc

ملف إضافي 4: تأثير TIR على توليف GFP عند 20 درجة مئوية. يتم توفير البيانات من القياسات التي تم إجراؤها عند 20 درجة مئوية لجميع سياقات المُحسِّن. (DOC 186 كيلوبايت)


شاهد الفيديو: كيف تبدأ في مجال الترجمة والعمل كمترجم (قد 2022).