معلومة

هل تعاني الخلايا التائية المتسللة من الورم من أي آثار طويلة الأمد بسبب نقص الأكسجة بعد عودتها إلى نورموكسيا؟

هل تعاني الخلايا التائية المتسللة من الورم من أي آثار طويلة الأمد بسبب نقص الأكسجة بعد عودتها إلى نورموكسيا؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

يعد العلاج بنقل الخلايا بالتبني (ACT) باستخدام الخلايا الليمفاوية المتضخمة للورم (TIL) في طليعة علاجات الأورام المناعية التي تتضمن الورم الميلانيني النقيلي ومؤشرات أخرى (1). تكمن الفكرة في أنه في مرحلة ما أثناء نمو الورم ، حاولت بعض الخلايا التائية تكوين استجابة مناعية ، وتسللت إلى الورم ، لكنها أصبحت مرهقة ومرهقة. يتضمن العلاج نفسه إخراج هذه الخلايا من بعض الورم المستأصل ، وعكس حالتها ، وبما أنها بالفعل مستضد جديد محدد من محاولة الهجوم على هذا السرطان: قم بتوسيعها ، ووضعها مرة أخرى في المريض ، ودعها تصيب الورم أصعب بكثير من ذي قبل.

لا تحتاج فقط إلى عكس الإرهاق في TIL ، ولكن تحتاج أيضًا إلى الحصول على المجموعة الصحيحة من الخلايا التائية للحصول على أفضل استجابة. العوامل المعنية تتجاوز هذا السؤال ، ولذا سأصل إلى هذه النقطة.

في بيئة الورم ، تصبح الخلايا التائية منهكة ويتغير شكل تعبيرها (2). يجعلهم أكثر عرضة للاستماتة ويفقدون وظائف المستجيب مثل إنتاج GranzymeB. يمكنك معرفة كيف أن هذا يمثل مشكلة. أشك في أن الخلايا التائية قد تصبح ناقصة التأكسج في الورم ، وما نعرفه هو أنه في مسار استشعار الأكسجين ، تؤثر العوامل المحفزة لنقص الأكسجة تأثيرها. عادة ، يجب أن يتم فحصها عن طريق تثبيط البروتينات إذا تم إنتاجها تحت نورموكسيا:

وهكذا على سؤالي:

بعد التعرض لفترات طويلة ل نقص الأكسجة، هل هناك أي تغييرات تنظيمية أو نصية بعد العودة لفترات طويلة إلى نورموكسيا تقديم أي من HIF1α أو HIF2α نشيط حيث يتم عادة قمعهم؟

سواء كنت بحاجة إلى مجموعة جديدة من العيون أو أن البيانات غير موجودة ، فأنا لم أجدها بالضرورة بشكل واضح. أود أن أعرف ما إذا كان هناك إطار تنظيمي شبيه بنقص الأكسجة المتبقي يبقى بعد عودة O2 إلى وضعها الطبيعي والتي تؤثر على مسارات مثل mTORC1 / 2. شكرا إذا تقدم لأية أفكار!


التكيف القلبي الوعائي لنقص الأكسجة ودور المقاومة المحيطية

يتم تنظيم ضغط الأوعية الدموية الجهازي في الفقاريات من خلال مجموعة من العوامل: أحد العناصر الرئيسية للتحكم هو المقاومة المحيطية في طبقات الأنسجة الشعرية. العديد من جوانب العلاقة بين التحكم المركزي في تدفق الأوعية الدموية والمقاومة المحيطية غير واضحة. ومن الأمثلة المهمة على ذلك العلاقة بين استجابة نقص الأكسجين في الأنسجة الفردية ، وتأثير تلك الاستجابة على التكيف القلبي الوعائي الجهازي مع الحرمان من الأكسجين. نوضح هنا كيف تؤثر استجابة نقص الأكسجين عبر عوامل النسخ HIF في سرير وعائي كبير واحد ، والذي يقع تحت الجلد ، على استجابة القلب والأوعية الدموية لنقص الأكسجة في الفئران. لقد أظهرنا أن استجابة الجلد لنقص الأكسجة تتغذى على مجموعة واسعة من معايير القلب والأوعية الدموية ، بما في ذلك معدل ضربات القلب والضغط الشرياني ودرجة حرارة الجسم. تمثل هذه البيانات أول عرض للدور الديناميكي لاستشعار الأكسجين في الأنسجة الطرفية التي تعدل بشكل مباشر استجابة القلب والأوعية الدموية لتحدي نقص الأكسجة.


تعريف نقص الأكسجين في الورم

نورموكسيا و physoxia

على الرغم من الدراسات العديدة حول نقص الأكسجة في الورم ، هناك ارتباك كبير في استخدام المصطلحات "نورموكسيا" و "نقص الأكسجة". تظهر قياسات الأوكسجين في الأنسجة الطبيعية أنها تظهر نطاقات طبيعية متميزة ، والتي تختلف بين الأنسجة (الجدول 1). ومع ذلك ، يتم استخدام "نورموكسيا" بشكل عام تقريبًا لوصف مستويات الأكسجين "الطبيعية" في قوارير زراعة الأنسجة ، بمعنى آخر. حوالي 20-21٪ أكسجين (160 مم زئبق). على الرغم من أن هذا ليس دقيقًا ، لأنه يعتمد على الارتفاع وثاني أكسيد الكربون المضاف2، في معظم الحالات ، 20٪ هو تقدير تقريبي جيد. على الرغم من الاستخدام الواسع النطاق لـ "normoxia" ، إلا أن هذا أبعد ما يكون عن المقارنة الدقيقة لأكسجة الأنسجة المحيطية. حتى في الحويصلات الهوائية في الرئة ، ينخفض ​​مستوى الأكسجين إلى حوالي 14.5٪ أكسجين (110 ملم زئبق) بسبب وجود بخار الماء وانتهاء صلاحية ثاني أكسيد الكربون2. 13 ينخفض ​​بشكل أكبر في الدم الشرياني ، وبحلول الوقت الذي يصل فيه إلى الأنسجة المحيطية ، يتراوح متوسط ​​مستويات الأكسجين من 3.4٪ إلى 6.8٪ بمتوسط ​​يبلغ حوالي 6.1٪ (الجدول 2). 13

الجدول 1. المستويات التقريبية للأكسجين في الأنسجة السليمة والأورام

أ من المستحيل وضع أرقام دقيقة لمستويات الأنسجة. القيم المقدمة هي دليل مشتق من عدة مصادر (انظر أيضًا الجدول 2).

ب تحدث الاستجابات الفسيولوجية الطبيعية لنقص الأكسجة أعلى من 15 مم زئبق (2٪ أكسجين). يجب ألا تقل الأنسجة الطبيعية عن هذا لأن التوازن يميل إلى إعادة مستويات الأكسجين إلى physoxia. لا يُعرف مستوى الأكسجين الدقيق لتنظيم جينات استجابة نقص الأكسجة ، فقد يختلف بين أنواع الأنسجة / الخلايا المختلفة نظرًا لأن الأنسجة الطبيعية لها مستويات أكسجين مختلفة.

ج وجود نقص الأكسجة المرضي يشير إلى أن الأنسجة لم تكن قادرة على العودة إلى physoxia. في الأنسجة الطبيعية ، يؤدي استمرار انخفاض الأكسجين إلى نخر الأنسجة ، والذي يمكن أن يكون له عواقب وظيفية كبيرة. يمكن أن يحدث هذا أيضًا في الأورام. نظرًا لأن الورم هو نمو غير طبيعي ، فإن فقدان الأنسجة من خلال النخر ليس له أهمية وظيفية معروفة. ومع ذلك ، فإن الخلايا السرطانية المقاومة لنقص الأكسجة ستصبح في البداية هادئة في نهاية المطاف ، وسيكون هناك اختيار للخلايا السرطانية الخبيثة التي تتحمل نقص الأكسجة.

الجدول 2. ملخص للقيم المبلغ عنها للضغط الجزئي للأكسجين (pO2) في أورام الإنسان والأنسجة الطبيعية ذات الصلة

نلم يتم تحديد عدد المرضى ND.

البيانات الواردة في الجدول هي في الأساس ملخص من التحليل التلوي الذي أجراه Vaupel et al. 5 يُشار إلى عدد الدراسات المتضمنة لكل نوع من أنواع الورم بالرقم الموجود في عمود "نوع الورم". البيانات الأخرى مأخوذة من دراسات فردية ، على النحو المشار إليه. القيم "المتوسطة" النهائية للأكسجين الورم والأنسجة الطبيعية هي قيم إرشادية فقط تم تقديمها لتوضيح التباين بين القيمتين. النطاق كبير ويعكس أصل الأنسجة المختلفة للأورام على الرغم من ذلك ، هناك تداخل محدود للغاية مع بيانات الأنسجة الطبيعية. (تم حساب المتوسطات بتعديل عدد القيم في كل مجموعة.)

أ - الحد من الورم ضد يعتمد النسيج الطبيعي على جميع البيانات الواردة في الجدول (باستثناء البروستاتا ، انظر المزيد من الملاحظات).

b يتم حساب التخفيض الطي على قياسات معاصرة في العضلة القطنية.

(ج) بيانات من دراسة تجريبية تضمنت قيمًا من البروستاتا "الطبيعية" لاثنين من مرضى سرطان المثانة.

وهذا يسلط الضوء بوضوح على شذوذ مصطلح "نورموكسيا". نظرًا لأن الأنسجة المحيطية الطبيعية تتعرض لمستويات أكسجين أقل بحوالي 75٪ من الهواء الملهم ، فمن المقترح أن 5٪ أكسجين (38 ملم زئبقي) هو تقريب أكثر دقة لأكسجة الأنسجة وأنه ينبغي التعرف على هذا على أنه "physoxia" مقابل يجب مقارنة الظروف. لا يقبل الباحثون مثل هذه القيمة غير الدقيقة للمعلمات الأخرى مثل الأس الهيدروجيني والجلوكوز وما إلى ذلك ، ومع ذلك ، من المدهش أنهم يتجاهلون أهمية التحكم في الأكسجين ، والذي عُرف لسنوات عديدة بكونه سامًا. 34 وتجدر الإشارة إلى أن موازنة وسائط الاستنبات مع مستوى الأكسجين في خليط غاز معين يمكن أن تستغرق ما يصل إلى 3 ساعات و 35 يمكن تجنب ذلك إذا كان خليط الغاز على اتصال مباشر مع الطبقة أحادية الطبقة ، والتي يمكن تحقيقها إذا كانت الخلايا نمت في قوارير نفاذية للأكسجين (www.coylab.com). نظرًا لأن النسبة المئوية للأكسجين ذات مغزى فسيولوجي أكبر من ملم زئبق ، يُقترح أن النسبة المئوية للأكسجين هي وحدة أفضل للإبلاغ عن مستويات الأكسجين لأنها توضح بشكل كافٍ مستويات الأكسجين المنخفضة نسبيًا ، ولكن بشكل واضح ، في العديد من الأنسجة ، كما أنه يسلط الضوء بشكل أفضل على المستويات المنخفضة بشكل خاص من الأكسجين الموجود في الأورام. (ملاحظة: وحدة SI لضغط الغاز هي kpascal لحسن الحظ أن 100٪ أكسجين يعادل 101.3 كيلو باسكال ، لذلك فإن هذه الوحدات تكاد تكون مكافئة عدديًا.)

الحد الأدنى من physoxia حوالي 3٪ أكسجين (23 مم زئبق) (الجدول 1). يحافظ الاستتباب على المعلمات الفسيولوجية ضمن حدود ضيقة مع وجود أنسجة فردية لها مستويات أكسجين متوسطة مفضلة (الجدول 2 انظر أيضًا Carreau et al 13). يشير هذا الاختلاف إلى أن الخلايا من أصول مختلفة لها حساسيات أكسجين مختلفة ، ومن المعروف أيضًا أن الأنسجة الطبيعية لديها مجموعة من التحمل لتقليل الأكسجين. أنسجة المخ حساسة بشكل خاص ويمكن أن تعيش لمدة 3 دقائق فقط بدون أكسجة كافية ، في حين أن الأنسجة الأخرى أكثر تحملاً ، على سبيل المثال الكلى والكبد (15-20 دقيقة) والعضلات الهيكلية (60-90 دقيقة) والعضلات الوعائية الملساء (24-72 ساعة) والشعر والأظافر (عدة أيام). 36

نقص الأكسجة الفسيولوجية

يمكن بعد ذلك تعريف "نقص الأكسجين الفسيولوجي" على أنه مستوى الأكسجين الذي تستجيب عنده الأنسجة للحفاظ على مستوى الأكسجين المفضل لديها. يمكن أن يكون ذلك بالوسائل الفسيولوجية ، على سبيل المثال توسع الأوعية ، وزيادة تدفق الدم ، و / أو تنظيم جينات الاستجابة لنقص الأكسجة. 12 نظرًا لأن physoxia يختلف باختلاف الأنسجة الفردية ، فمن المحتمل أن يكون لديهم نقاط تحفيز مختلفة لنقص الأكسجة يحدث تحتها. في الأنسجة الطبيعية ، من المفترض أن يكون هذا مؤقتًا ولكنه كافٍ لإعادة الأنسجة إلى مستوى الأكسجين المفضل لديها. ومع ذلك ، نظرًا لأن الأنسجة الطبيعية يتم الحفاظ عليها عادةً عند 3-7٪ أكسجين ، فمن المحتمل أن يكون نقص الأكسجة الفسيولوجي في نطاق 2-6٪ أكسجين. يشير هذا إلى أن عناصر استجابة نقص الأكسجة قد تنتظم جيدًا عند مستويات الأكسجين المختلفة في الأنسجة المختلفة. في الوقت الحالي ، من الصعب تصور كيف يمكن قياس "نقص الأكسجة الفسيولوجي" حيث يجب أن يعمل الاستتباب لعكسه على الفور تقريبًا ، لذلك فإن أي مظهر سيكون مؤقتًا. سيتم الحفاظ على هذا من خلال عدد من التغييرات ، بما في ذلك الزيادات في التروية والاستقرار المؤقت للعامل المحرض لنقص الأكسجة (HIF) ، أثناء إجراء عمليات إعادة الضبط. 37 عندما تم قياس تعبير HIF1α و HIF1β في خلايا هيلا المستزرعة من 0٪ إلى 20٪ أكسجين ، تم العثور على استجابة قصوى عند 0.5٪ أكسجين مع تعبير نصف الحد الأقصى عند 1.5-2٪ تعبير أكسجين منخفض بشكل ملحوظ فوق 4٪ أكسجين ، 38 تؤكد أن HIF1 نشط في النطاق المطلوب للتحكم في الاستجابات الفسيولوجية لحرمان الأكسجين (تمت مناقشته بمزيد من التفصيل أدناه).

نقص الأكسجة المرضي

بعد تحديد النطاق التقريبي "لنقص الأكسجة الفسيولوجي" ، يساعد هذا في تحديد مستويات الأكسجين الموجودة في علم الأمراض. في الواقع ، هذا يطرح السؤال ، لماذا في الأنسجة المرضية لا تستجيب آليات الاستتباب بفعالية لعكس مستويات الأكسجين المتساقطة؟ في مرض نقص تروية الدم ، والذي يمكن أن يكون مزمنًا (على سبيل المثال في مرض السكري ، وانخفاض وظائف الرئة وما إلى ذلك) أو الحاد (على سبيل المثال السكتة الدماغية وانسداد الشريان التاجي وما إلى ذلك) ، قد لا يكون من الممكن إعادة إنشاء التوازن بسبب فقدان / انسداد / انخفاض تدفق الأوعية التي تغذي الأنسجة المعنية. ومع ذلك ، في الأورام ، غالبًا ما يكون هناك تحسن في تكوين الأوعية الدموية ، لكن مستويات الأكسجين (حتى في الأورام غير المعالجة) تكون أقل بشكل ملحوظ ، وتتراوح من 0.3٪ إلى 4.2٪ أكسجين (2–32 ملم زئبق) ، مع انخفاض جميعها تقريبًا إلى أقل من 2٪ (الجدول 2). من المسلم به عمومًا أن الأوعية الدموية للورم فوضوية وتتكون من أوعية راشحة ذات نهايات عمياء وتحويلات وتميل إلى الانهيار. 39 من الواضح أن الأوعية الدموية تفشل فشلاً ذريعًا في الحفاظ على مستويات الأكسجين ، والتي تكون أقل بكثير من الأنسجة الطبيعية المجاورة (الجدول 2) ، على الرغم من الأدلة في العديد من المواقف على أن HIF1 يتم تنظيمه. 40

لذلك ، من الواضح أن الأورام تتكيف جيدًا للنمو والتوسع في هذه البيئة الدقيقة للورم الذي يستنفد الأكسجين باستمرار (TME). عند تعريف "نقص الأكسجة المرضي" ، لا توجد معطيات مطلقة ، ولكن الحقيقة هي أن جميع الأورام تميل إلى أن يكون متوسط ​​مستويات الأكسجين في الورم & lt2٪ ، وضمن هذا التقدير ، يمكن أن تختلف القياسات الفردية من حوالي 6٪ (نادرًا جدًا) إلى صفر مع انحراف ملحوظ بشكل ملحوظ نحو الطرف الأدنى من هذا النطاق بشكل متكرر ، معظم القيم أقل بكثير من 1.3٪ أكسجين (10 مم زئبق) ، خاصة في الأورام التي تعاني من نقص الأكسجة. تم العثور على العديد من الأمثلة على هذا التوزيع غير الغاوسي في المنشورات المذكورة في الجدول 2.

في الأورام ، يبدو أن عمليات الاستتباب تتعطل لسببين رئيسيين. أولاً ، الأوعية الدموية ذات نوعية رديئة للغاية ولا يمكنها توفير الأكسجين بشكل كافٍ وموثوق للورم النامي. في الواقع ، إذا كانت الخلايا السرطانية المفترضة حساسة لانخفاض الأكسجين فإنها ستموت لأن مستويات الأكسجين غير كافية. وهذا يؤدي إلى السبب الرئيسي الآخر: من الواضح أن الخلايا السرطانية لا تموت ، مما يدل على أن نسبة كبيرة منها تتحمل نقص الأكسجة بشكل كبير. قد يُعزى هذا جزئيًا إلى تحولهم إلى تحلل السكر لتوفير معظم احتياجاتهم من الطاقة ، وهي سمة من سمات الأورام التي حددها واربورغ منذ سنوات عديدة. 41 بالإضافة إلى ذلك ، فإن التعرض لنقص الأكسجة المرضي لفترات طويلة سيختار الخلايا السرطانية التي تتحمل نقص الأكسجة والتي تكون مقاومة للإجهاد وأكثر خبيثة (انظر أدناه). من الصعب أن تكون دقيقًا بشأن المستوى الدقيق للأكسجين الذي يحدث عنده هذا ، ومع ذلك ، فمن شبه المؤكد أن 1٪ أكسجين (7.5 مم زئبق) وقد يكون أقل بكثير. وتجدر الإشارة إلى مدى تكيف الخلايا السرطانية مع مستويات الأكسجين المنخفضة بشكل ملحوظ. في إحدى الدراسات ، تسبب نقص الأكسجة في موت الخلايا السرطانية فقط عندما كانت مستويات الأكسجين & lt0.01٪ (0.075 ملم زئبق) لأكثر من 24 ساعة. 42 في دراساتنا ، نجت نسبة من الخلايا السرطانية LNCaP من التعرض في المختبر إلى 48 ساعة أو أكثر من 0.1٪ أكسجين. 43 في الآونة الأخيرة ، أظهرنا أن متوسط ​​مستوى الأكسجين لطعوم أجنبي البروستاتا LNCaP المعالج ببيكاليوتاميد ظل أقل من 0.1 ٪ أكسجين لأكثر من 10 أيام. 44 بشكل عام ، فإن البقاء على قيد الحياة في هذا الضغط الشديد سيؤدي إلى انتقاء الأنماط الظاهرية الخبيثة التي تحكمها عملية الانتقاء الداروينية. 45

تقلب في أكسجة الورم

عادةً ما يتم الإبلاغ عن أكسجة الورم كقيمة متوسطة ، ومع ذلك ، هناك تغايرية كبيرة داخل الأورام الفردية. 5 بالإضافة إلى ذلك ، فإن الأوكسجين الجزئي غير مستقر ، وتتقلب مستويات الأكسجين داخل الورم اعتمادًا على وظيفة الأوعية الدموية المحلية وقربها. 46 في الواقع ، لقد ثبت في أورام الفئران أن بعض الاختلاف في الأوكسجين يمكن أن يعزى إلى التغيرات في تدفق الخلايا الحمراء. 47 ستتلقى الخلايا السرطانية "الأفضل أكسجينًا" حول الشعيرات الدموية العاملة بعض الأكسجين ، على الرغم من أنه نادرًا ما يكون بنفس القدر الذي تتلقاه الخلايا الطبيعية (الجدول 2). ومع ذلك ، فهو كافٍ للسماح بانقسام الخلايا ونمو الورم ، والذي يتم تعزيزه بشكل شبه مؤكد من خلال المستوى المعزز لتحلل السكر المذكور أعلاه. في الواقع ، يمكن أيضًا تسهيل ذلك من خلال انخفاض مرتبط في نشاط الميتوكوندريا. 48 عندما تنقسم الخلايا وتبتعد عن الشعيرات الدموية ، فإنها تتلقى كمية أقل من الأكسجين وتكون الخلايا البعيدة ناقصة التأكسج بشكل مزمن 49 في النهاية ، تموت الخلايا وتصبح الأنسجة نخرية. في الأقسام النسيجية ، غالبًا ما يُنظر إلى الخلايا القابلة للحياة على أنها "حبال" من الخلايا التي تنمو بنشاط حول الأوعية الدموية المروية حتى حوالي 150 ميكرومتر ، على الرغم من أن هذه المسافة هي متغير آخر يتم اقتباسه بشكل مختلف من 70 إلى 200 ميكرومتر. 2،47،50،51 ربما يرتبط التباين بعاملين رئيسيين: (1) متطلبات الأكسجين لنوع معين من الخلايا السرطانية و (2) تحمل نقص الأكسجة. كلما زادت نشاط الخلايا في التمثيل الغذائي ، كلما كانت حبال الورم أصغر. بمجرد أن تصبح الخلايا ناقصة التأكسج من الناحية المرضية ، فإن نسبة الخلايا في هذا الجزء ستعتمد على تحملها لنقص الأكسجة. كلما كانوا أكثر تحملاً ، كلما ظلوا هادئين لفترة أطول ، ومع ذلك لا يزالون قادرين على البقاء ، مما يؤدي إلى ورم ناقص التأكسج أكثر نسبيًا مع جزء كبير من نقص الأكسجين. وعلى العكس من ذلك ، فإن الخلايا السرطانية الحساسة لنقص الأكسجة ستموت بسرعة أكبر ، لذلك سيكون الجزء الناقص التأكسج أصغر.

بالإضافة إلى ذلك ، نظرًا لأن الأوعية الدموية غير كافية والتصريف اللمفاوي غير موجود تقريبًا ، فإن الضغط الخلالي يتقلب ، مما يتسبب في انهيار الأوعية الدموية المتقطع. ستصبح الخلايا حول الوعاء الدموي المنهار "ناقصة التأكسج بشكل حاد". يمكن أن تختلف المدة التي يمكن أن يستمر فيها هذا ولكن في أورام الحيوانات تتراوح من 20 دقيقة إلى عدة ساعات. 52،53 من الواضح أن هذا وضع ديناميكي وقد يكون مرة أخرى أطول / أقصر بكثير من الأرقام المذكورة لأن الأرقام تتعلق بالأوقات المحددة في الدراسات المنشورة (راجعها Bayer و Vaupel 54). من المحتمل أن تكون الخلايا الموجودة في هذه الحجرة (إذا لم تموت) في دورة ، خاصة إذا كان نقص الأكسجة الحاد قصيرًا. سيكونون قادرين على إعادة توطين الورم بسرعة أكبر من الخلايا الهادئة "ناقصة التأكسج المزمن". ومع ذلك ، ستتم حمايتهم من RT (بسبب نقص الأكسجين) أو CCT (بسبب نقص التسليم) ، إذا تم إغلاق الأوعية أثناء فترة التعرض للعلاج. هناك بعض الأدلة التي تشير إلى أن الخلايا التي تعاني من نقص الأكسجة الحاد هي التي من المرجح أن تساهم في تطور الورم الخبيث. 54-56

لذلك من المتوقع أن تكون الاختلافات في قراءات أكسجة الورم متوقعة بالفعل ، فالقراءات الفردية تختلف عبر الورم ، وإن كان ذلك عند مستويات الأكسجين الموجودة بشكل أساسي في النطاق المرضي. 46 في الدراسات السريرية ، غالبًا ما تكون المستويات المتوسطة في أنواع الأورام المختلفة من دراسات مختلفة متشابهة ، وإن لم تكن دائمًا (الجدول 2). يعطي هذا الثقة في أن القياسات حقيقية وأن المتوسطات ، على الرغم من أنها تستند إلى انتشار كبير للقراءات الفردية ، توفر مؤشرًا حقيقيًا للأكسجين الوسيط في كتلة الورم. في LNCaP xenografts ، وجدنا أن متوسط ​​مستوى الأكسجين في الأورام المعالجة بالمركبة قابل للتكاثر بشكل كبير (نناقش أدناه). 44 في البشر ، ثبت أن متوسط ​​مستوى الأكسجين في أنسجة الثدي الطبيعية كان ثابتًا بشكل ملحوظ بغض النظر عن مستوى الهيموجلوبين في الدم. كان هذا على النقيض من أورام الثدي ، والتي أظهرت انخفاض ملحوظ في مستوى p O2 من الأنسجة الطبيعية وكذلك انخفاض ، في هذا المستوى المنخفض بالفعل ، حيث انخفض تركيز الهيموجلوبين. 57

نقص الأكسجة الورم والتطور الخبيث

ليس من المستغرب أنه من الواضح الآن أن نقص الأكسجة يسبب العديد من التغيرات الجينية في الغالب ، ولكن ليس حصريًا ، بوساطة HIF1 و HIF2. 40 كما نوقش أعلاه ، في الخلايا الطبيعية ، يشارك تعبير HIF1 في الحفاظ على أكسجة الأنسجة ضمن الحدود الطبيعية. تم تصميم استجابته لتكون فورية تقريبًا نظرًا لأن عامل النسخ النشط HIF1 يتكون من HIF1β المعبر عنه بشكل أساسي والبروتين غير المستقر HIF1α. يتم إنتاج الأخير وتفكيكه باستمرار ، وبالتالي الحفاظ على مستواه منخفضًا بشكل ملحوظ في خلايا physoxic. بمجرد أن ينخفض ​​مستوى الأكسجين ، يتم منع إزالة HIF1α مما يسمح بتكوين مركب HIF1 ، مما يؤدي على الفور إلى حدوث عدد كبير من التغييرات ، والتي تؤدي في الخلايا الطبيعية إلى العودة إلى ظروف physoxic. ومع ذلك ، في الأورام ، غالبًا ما يستمر تعبير HIF1 بغض النظر عن مستوى الأكسجين ، وهذا يشير إلى وجود استجابة تكيفية في الخلايا السرطانية تجعلها أقل اعتمادًا على الأكسجين. في بعض الخلايا السرطانية ، يمكن أن يكون هذا تغييرًا أساسيًا في تعبير HIF ، وفي حالات أخرى ، يحدث هذا بسبب تغيير جيني لواحد أو أكثر من مجموعة البروتينات المعقدة التي تتحكم عن كثب في تعبير HIF في الخلايا الطبيعية. 37،58 هذا يؤسس نمطًا ظاهريًا مختلفًا تمامًا عن الخلايا الطبيعية (physoxic). من المفيد أن تكتسب الخلايا السرطانية المتكيفة احتياجات أقل بكثير من الأكسجين ، مما يؤدي إلى تحسن ملحوظ في قدرتها على البقاء في ظروف نقص الأكسجين المرتبطة بقدرتها على استخدام تحلل السكر لتوفير احتياجاتها من الطاقة. 41 ، 48

يشجع التحول إلى النمط الظاهري الخاضع للتنظيم HIF1 على الانتقاء لمئات الجينات ، والتي يرتبط الكثير منها بنمط ظاهري خبيث أكثر. على سبيل المثال ، هناك تحول إلى نمط ظاهري أكثر تولدًا للأوعية مع زيادة تنظيم الجينات ، مثل عامل النمو البطاني الوعائي (VEGF) والإنترلوكين 8 (IL8) ، في حين يتم تنظيم مثبطات تكوين الأوعية الدموية ، على سبيل المثال أنجيوستاتين وإندوستاتين. تشمل الجينات / المسارات الأخرى المتورطة في استجابة نقص الأكسجة هذه العامل النووي κ B ، والبروتين المنشط -1 ، والهدف الثديي لراباميسين كيناز واستجابة البروتين غير المطوية. 59-61 على الرغم من تنشيط هذه الجينات / المسارات بشكل مستقل ، مما يشير إلى التكرار في المسارات الحساسة للأكسجين ، هناك أيضًا دليل على أنها يمكن أن تستجيب لنقص الأكسجة بطريقة متكاملة. 62

أظهرت الدراسات المبكرة أن نقص الأكسجة المختار للخلايا ذات العيوب في موت الخلايا المبرمج. 6 أكدت تقارير أخرى أن نقص الأكسجة يمكن أن يفرض ضغط اختيار يسمح بتوسيع البديل النسيلي في المختبر 43،63،64 و في الجسم الحي. أظهرت الدراسات التي أجريت في مختبرنا أن الفئران التي تحمل طعم أجنبي LNCaP المعرضة لنقص الأكسجة الناجم عن البيكالوتاميد قد زاد من ورم خبيث في الرئتين وهذا مرتبط بزيادة في Bcl2 وانخفاض في Bax. 44 تم الإبلاغ أيضًا عن تضخيم الجينات في خلايا الورم القوارض المكشوفة خارج الجسم الحي أو في الجسم الحي إلى نقص الأكسجة ارتبط هذا بزيادة في النقائل. 65،66 في كل من زراعة الأنسجة والنماذج الحيوانية ، تم ربط نقص الأكسجة / إعادة الأكسجة الحاد بتحريض فواصل شرائط الحمض النووي ، ومن الواضح ، إذا لم يتم إصلاح هذه الفواصل ، فإنها ستؤدي إلى مزيد من الطفرات. في الواقع ، هناك دليل كبير على أن عمليات إصلاح الحمض النووي في الأورام يتم تعديلها أيضًا عن طريق نقص الأكسجة وأن هذا مرتبط بزيادة عدم الاستقرار الجيني. 67

أظهرت دراسات أخرى أن نقص الأكسجة يمكن أن يزيد من التقدم الخبيث / ورم خبيث عن طريق تنظيم الجينات المرتبطة بالورم الخبيث ، مثل osteopontin و lysyl oxidase و CXCR4 و IL8 و VEGF وغيرها الكثير ، بشكل أساسي من خلال تثبيت HIF1. 68-70 قد يترافق هذا أيضًا مع زيادة MDM2 ، وهو مثبط لـ p53 ، و في الجسم الحي هذا يؤدي إلى مقاومة موت الخلايا المبرمج وزيادة تكوين النقائل. 71،72 مؤخرًا ، ثبت أن العلاج الإشعاعي يمكن أيضًا اختيار الخلايا السرطانية التي تفرط في التعبير عن HIF1. بعد التشعيع ، في الجسم الحي تنتقل الخلايا المفرطة في التعبير عن HIF1 نحو الأوعية الدموية للورم ، ويمنع تثبيط HIF1 هذا التأثير ويقلل أيضًا من إعادة نمو الورم. 73

من المستحيل مناقشة جميع التغييرات الجينية التي تم الإبلاغ عنها استجابة لنقص الأكسجة (لمزيد من المراجعات التفصيلية انظر 59،74-76). ومع ذلك ، هناك قضية واحدة تحتاج إلى تعليق. غالبًا ما يتم قياس التغيرات الجينية الناتجة عن نقص الأكسجة في المختبر ومقارنة مع "نورموكسيا". يتم وصف هذا بشكل متكرر ، أو يُفترض إذا لم يتم تعريفه ، على أنه هواء يحتوي على 5٪ من ثاني أكسيد الكربون2 (بمعنى آخر. حوالي 20٪ O2) بشكل مفاجئ ، من النادر العثور على أي تعليق حول صحة هذا الافتراض. ومع ذلك ، كما نوقش أعلاه ، سيكون أكثر ملاءمة للأنسجة الطبيعية إذا تم الحفاظ على خلايا التحكم في physoxia ، بمعنى آخر. 5٪ O2، ومقارنة بنقص الأكسجة الفسيولوجي (1-3٪) ونقص الأكسجة المرضي (0.5-0.1٪). (يتم تقديم هذه الأرقام كنطاقات ، حيث أن مستوى الأكسجين ذي الصلة بفحص معين سيعتمد على أصل الورم والأنسجة الطبيعية ذات الصلة - انظر الجدول 2 لمعرفة القيم ذات الصلة.) ومع ذلك ، نادرًا ما تؤخذ مستويات الأكسجين في الاعتبار في علم الوراثة دراسات في المختبر، على الرغم من أنه من المحتمل أن يكون أمرًا بالغ الأهمية لتحديد ومقارنة ما يحدث في الأنسجة الكاملة أو الأورام بشكل واضح.

عدم وجود ارتباط بين في المختبر تم تأكيد الخلايا والأورام الصلبة في دراسة حديثة حددت المئات من مواقع ارتباط مستقبلات الأندروجين (ARBSs) في خزعات ورم البروستاتا البشرية. لم يتم تحديد غالبية ARBSs في خلايا ورم البروستاتا LNCaP المزروعة في المختبر ومع ذلك ، تم العثور على العديد في نفس الخلايا التي نمت على شكل طعم أجنبي في الفئران المحرومة من الأندروجين (المخصي). تم التعرف على مجموعة توقيع مكونة من 16 جينًا من الخزعات البشرية التي تفوقت على توقيع أكبر مشتق من الخلايا المستنبتة ، كما تم تحديدها أيضًا في أورام LNCaP المطعمة بالجنين ولكن ليس في خلايا LNCaP المزروعة في المختبر، مما يشير إلى أن TME له تأثير كبير في التحكم في إشارات مستقبلات الأندروجين في أورام البروستاتا. 77 وهذا يؤكد مرة أخرى أنه ينبغي توخي الحذر عند مقارنة البيانات من في المختبر الدراسات ، خاصة عندما تزرع الخلايا في "نورموكسيا".

استتباب الأكسجين في البيئة الدقيقة للورم والاستجابة للعلاج

لماذا لا تستجيب آليات الاستتباب لاستعادة توازن الأكسجين في الأورام؟ من الواضح أن تكون الأوعية الدموية يتم تحفيزها ، ولكن الأوعية الدموية المتكونة غير كافية للحفاظ على الأكسجين عند مستويات التورم على الرغم من تكوين الشعيرات الدموية الواسع في العديد من الأورام. إذا استجابت الخلايا السرطانية لضغط نقص الأكسجة لفترات طويلة ، فإنها تتكيف / تحور لإنتاج مستويات أكثر تضخيمًا من العوامل المؤيدة لتولد الأوعية ، عندها ستزود الورم بميزة البقاء على قيد الحياة. بمجرد وصول العوامل المؤيدة لتولد الأوعية إلى المستويات الحرجة ، ستتحسن الأوعية الدموية (ربما تطبيع) 78 وسيعاود الورم النمو. لسوء الحظ ، عندما يحدث هذا ، فمن المرجح أن يتم إعادة تسكينها بخلايا أورام خبيثة مؤيدة لتولد الأوعية ومقاومة لنقص الأكسجة.

هذا بالضبط ما حدث عندما عولجت الفئران التي تحمل أورام LNCaP يوميًا ببيكالوتاميد ، وهو دواء يستخدم على نطاق واسع في سرطان البروستاتا المتقدم محليًا. كانت الطعوم xenografts LNCaP غير المعالجة ضعيفة الأكسجين (0.8 ٪ أكسجين 6 مم زئبق) وكان هذا مشابهًا لمستويات الأكسجين الموجودة في الدراسات السريرية (0.9 ٪ أكسجين ، 7 مم زئبق الجدول 2). عندما عولجت الفئران يوميًا ببيكاليوتاميد لمدة 28 يومًا ، انخفض مستوى الأكسجين بشكل سريع خلال 1-3 أيام إلى -0.1٪ أكسجين ، واستمر هذا النقص العميق في الأكسجين لأكثر من 10 أيام. ومع ذلك ، خلال الأيام العشرة التالية ، ارتفعت مستويات الأكسجين ، وعادت إلى مستويات ما قبل العلاج تقريبًا. عندما نمت الأورام في الجسم الحي في غرف النوافذ ، لوحظ فقدان ملحوظ في الأوعية الدموية في الأيام الـ 14 الأولى من العلاج بالبيكالوتاميد متبوعًا بانفجار الأوعية الدموية. تُعزى هذه الاستجابة ثنائية الطور المميزة إلى انخفاض طفيف ، ثم زيادة أكبر ، في العوامل المؤيدة لتولد الأوعية ، بما في ذلك VEGF والأكثر وضوحًا IL8. من الواضح أن الخلايا السرطانية يمكن أن تنجو من التعرض لإهانة نقص الأكسجة العميقة ، وعلى الرغم من حصار الأندروجين ، تم عكس تثبيط النمو في نهاية المطاف عن طريق إنتاج عوامل كافية لتولد الأوعية لتحفيز تكوين الأوعية الدموية. من الواضح أن الخلايا السرطانية كانت قادرة على تبديل استخدام إمداداتها المحدودة من الطاقة لتجميع هذه العوامل الحاسمة. بعد 28 يومًا من العلاج ، كانت الخلايا السرطانية المستأصلة أكثر توغلًا وأكثر مقاومة للدوسيتاكسيل من الخلايا السرطانية المستأصلة من فأر مُعالج بالمركبة. بالإضافة إلى ذلك ، شهدت الفئران التي عولجت بالبيكلوتاميد زيادة ملحوظة في انتشار النقائل إلى الرئتين ، على الرغم من أنه يمكن منع ذلك بنجاح عن طريق العلاج في اليوم السابع بجرعة واحدة من عقار بانوكسانترون (AQ4N) ، وهو دواء أولي يستهدف على وجه التحديد الخلايا ناقصة التأكسج. 44

لم يتم التعرف على التأثير الأولي المضاد للأوعية لمضاد بيكالوتاميد الأندروجين على نطاق واسع ، على الرغم من أن الدراسات السابقة ، باستخدام نماذج الإخصاء في الغالب ، قدمت أدلة كثيرة على أنه من المحتمل حدوثه (تمت مناقشته في 44). أظهرت دراساتنا أن خلايا ورم البروستاتا شديدة التحمل لنقص الأكسجة. في أنواع الأورام الأخرى ، قد يختلف هذا إلى حد ما ، ومع ذلك ، تجدر الإشارة إلى أن خلايا ورم البنكرياس قد تكون متحملة بشكل خاص لنقص الأكسجة لأنها تنجو من مستويات الأكسجين أقل بـ19 ضعفًا من تلك الموجودة في أنسجة البنكرياس الطبيعية (الجدول 2). 23 عندما تم إنشاء طعم أجنبي مشتق من المريض لتقويم العظام في الفئران العارية ، تم قياس مدى نقص الأكسجة ، باستخدام علامة نقص الأكسجة EF5 ، للنمو العدواني والورم الخبيث التلقائي. 79 أورام البنكرياس البشرية مقاومة للعلاج بشكل خاص ، وهي خاصية تُعزى إلى السدى الواسع. 80 من المغري التكهن بأن مقاومة العلاج قد تنتج أيضًا عن اختيار الخلايا التي لديها القدرة على البقاء على قيد الحياة بمستويات أكسجين أقل بكثير من تلك الموجودة في البنكرياس الطبيعي والتي ، نتيجة لذلك ، لديها نمط ظاهري خبيث بشكل خاص.

إذا كان التعرض للأدوية التي تسبب نقص الأكسجة يمكن أن يختار خلايا الورم الخبيثة التي تتحمل نقص الأكسجين / ، فمن الممكن أن أي علاج يسبب نقص الأكسجة المتزايد والمطول يمكن أن يفعل الشيء نفسه. قد يكون هذا هو السبب الرئيسي وراء عدم نجاح عقاقير استهداف الأوعية الدموية ، المستخدمة كعامل منفرد ، كما كان متوقعًا في الأصل. في الواقع ، لوحظ وجود فائض كبير في المسارات المولدة للأوعية كما تم العثور على إعادة تكوين الأوعية بعد الاستجابات الأولية المضادة للأوعية الدموية (للمراجعة ، انظر 81). معظم العلاجات المضادة للسرطان إما (1) تستهدف الأوعية الدموية مباشرة أو (2) تستهدف الخلايا السرطانية التي تدعم عمل الأوعية الدموية للورم ، ولكن بشكل غير كافٍ. لذلك ، من الممكن أن تسبب العديد من العلاجات تأثيرات مبكرة (غالبًا غير معترف بها) مضادة للأوعية وزيادة مرتبطة بنقص الأكسجة. نظرًا لأن مستويات الأكسجين في معظم الأورام موجودة بالفعل في النطاق المرضي ، فقد يؤدي ذلك إلى إهانة خطيرة بسبب نقص الأكسجة.

لقد أظهرنا هذا في أورام البروستاتا PC3 باستخدام عقار docetaxel السام للخلايا ، والذي تسبب في تأثير مضاد لتولد الأوعية في وقت مبكر تم تعزيزه باستخدام الديكساميثازون. قد يفسر هذا سبب وجود فعالية قصيرة المدى (وإن لم تكن طويلة الأجل) لهذه المجموعة في المرضى الذين يعانون من سرطان البروستاتا النقيلي. 82 كما نوقش أعلاه ، فإن مضادات الأندروجين لها تأثير أولي وعميق مماثل على الأوعية الدموية للورم ، وهو تأثير وجدنا أيضًا مع أدوية أخرى مضادة للأورام مختلفة ميكانيكيًا (بياناتنا غير المنشورة). ومع ذلك ، يمكن للأورام أن تتكيف مع هذه الإهانة الناقصة الأوكسجين وتتعافى مع نمط ظاهري مؤيد لتكوين الأوعية ، وربما يكون خبيثًا. 44،83،84 يمكن التغلب على هذه المشكلة جزئيًا ، على الأقل ، عن طريق الدمج مع CCT الأخرى. تقدم العقاقير الأولية التي تنشط بنقص الأكسجة (HAPs) (التي تمت مناقشتها أدناه) نهجًا إضافيًا ، لأنها تستهدف على وجه التحديد الخلايا ناقصة التأكسج. من الواضح أن الفهم الأكبر للتغيرات الطولية في أكسجة الورم الناجم عن العلاجات الحالية مطلوب ، لجدولة تركيبات الأدوية بشكل أكثر فعالية ، بما في ذلك HAPs.


1 المقدمة

منذ فترة طويلة ، تم التعرف على أهمية الخلايا التائية وخاصة الخلايا الليمفاوية التائية CD8 + T السامة للخلايا (CTLs) في الحد من تطور الأورام المناعية. 1 ومن ثم فإن وجود CTLs داخل العديد من الأورام هو عامل تنبؤ إيجابي. 2 وعلى العكس من ذلك ، فإن ضعف الاستجابة المناعية المضادة للأورام هو السمة المميزة لنمو الأورام. 3 أدى مفهوم المراقبة المناعية التي تحركها الخلايا التائية ضد السرطان إلى تطوير علاجات مناعية تعتمد إما على تنشيط وظيفة الخلايا التائية في الموقع ، وبشكل أساسي عن طريق الأجسام المضادة التي تستهدف مستقبلات نقاط التفتيش المناعية ، أو على نقل الخلايا التائية المعدلة وراثيًا مع تعزيزها. النشاط المضاد للأورام ، وخاصة مستقبلات المستضدات الكيميرية (CAR) التي تعبر عن الخلايا التائية. 4 قدمت كلتا الاستراتيجيتين مستوى غير مسبوق من النشاط المضاد للأورام على المدى الطويل في المرضى الذين يعانون من العديد من السرطانات النقيلية. ومع ذلك ، فإن غالبية المرضى الذين يعانون من سرطانات متقدمة لا يزالون لا يعانون من فائدة سريرية مستدامة من العلاج المناعي ، مما يبرز وجود الحواجز التي يحتاج المرء إلى تحديدها من أجل تصميم استراتيجيات للتغلب عليها. قد تمثل الهجرة غير الفعالة للخلايا التائية ، ولا سيما اختراق كتلة الورم ، عقبة مهمة أمام العلاجات المناعية القائمة على الخلايا التائية. كدعم لهذه الفكرة ، أظهرت العديد من الدراسات السريرية أن الأورام المخصبة في الخلايا التائية أكثر عرضة للسيطرة عليها عن طريق حصار مبرمج لموت الخلايا -1 (PD-1). In contrast, tumors with so-called “immune deserts” and immune excluded profiles, in which T cell are present within tumors but not in contact with malignant cells, are refractory to PD-1 blockade. 5 Migration might represent an even greater challenge for CAR T cell therapy, because the in vitro expanded T cells that are infused into the blood circulation need to home to the site of tumor development and then migrate toward the tumor mass.

There is currently a wide gap in our knowledge of the homing and migratory properties of CAR T cells, as well as to the location of these therapeutic cells over prolonged periods. The objective of this review is therefore to address key open questions, such as: what are the capacities of infused therapeutic T cells to home to target organs? How does the tumor microenvironment influence the motility behavior of engineered T cells? What are the strategies, which have been implemented to restore a defective CAR T cell migration? How should homing and motility properties of adoptively transferred T cells be monitored in preclinical models? By highlighting these points, we hope to stimulate a research focus at the interface between basic T cell biology and therapeutic development that will ultimately open new opportunities to improve antitumoral T cell based strategies.


Hypoxia Diminishes Electron Transport

Multiple studies throughout the 1970s and 1980s examined the oxygen dependence of the ETC (108, 109). These studies observed that exposure of cells to acute hypoxia (minutes to seconds) did not attenuate the flux of electrons through the ETC nor increase NADH levels in mitochondria. However, in the mid-1990s we reported that isolated mitochondria decreased coupled respiration and that isolated COX decreased its maximal velocity (الخامسالأعلى) when exposed to chronic hypoxia (2 h) (30, 32). Thus there is an intrinsic oxygen dependence of COX during prolonged hypoxia. Another important regulator of COX activity is nitric oxide (NO) (36). Low concentrations (nM range) of NO reversibly inhibit isolated COX by competing with oxygen (15, 35, 80). Under aerobic conditions, oxygen levels are high enough to prevent NO from inhibiting COX activity (36). However, as oxygen levels fall, the low levels of NO are sufficient to inhibit COX activity. Low levels of NO under normoxia do not injure cells. However, the same low levels of NO are sufficient to inhibit respiration and initiate cell death under hypoxia (1.5% O2) (76). In the absence of NO, hypoxia alone does not have any deleterious effects on cells. It is likely that COX activity is compromised in inflammatory conditions where NO levels are high with concomitant tissue hypoxia. Furthermore, the NO-generating enzyme inducible NO synthase (iNOS) is a target of HIF-1 (65, 85). We propose that hypoxia diminishes COX activity by decreasing the الخامسالأعلى of COX activity and by increasing NO levels to inhibit COX activity. Although this mechanism diminishes COX activity during hypoxia, the activity cannot be diminished to the point where respiration fails to meet the basal metabolic demands of cells. Therefore, cells ensure optimal COX activity during hypoxia by activating HIF-1 to induce subunit switch from COX4–1 subunit to COX4–2 (44). COX has 13 subunits, of which the three catalytic subunits COX I-III are encoded by mitochondrial DNA. The remaining regulatory 10 subunits including COX4 subunits are encoded by nuclear DNA. HIF-1 induces both the expression of the COX4–2 subunit and the mitochondrial protease LON, which targets COX4–1 subunit degradation to complete the switching of the COX4 subunits during hypoxia. Recently, another mechanism to downregulate the ETC is the finding that micro-RNA 210 (mir-210) blocks the expression of the iron-sulfur cluster assembly proteins ISCU1/2, which are required for the functions of complex I, COX subunit 10, aconitase, and subunit D of succinate dehydrogenase (28, 33, 42, 91). Using a miRNA microarray, Kulshreshta et al. (74) first discovered that miR-210 is regulated by hypoxia, and recently it was proposed to be the major micro-RNA upregulated during hypoxia. HIF-1, but not HIF-2, is responsible for the induction of mir-210 during hypoxia (57). The ectopic expression of mir-210 is sufficient to decrease mitochondrial respiration and upregulate glycolysis (33). Thus there are multiple mechanisms by which HIF-1 can coordinately diminish electron flux through the ETC (Fig. 3).

تين. 3.Hypoxia diminishes electron flux through the electron transport chain. Hypoxia diminishes respiratory activity by activating HIF-1, which increases micro-RNA 210 (miR-210), inducible nitric oxide synthase (iNOS), and switching of cytochrome ج oxidase (COX)4–1 subunit to COX4–2. Hypoxia can also directly decrease complex IV (COX) activity.


3 نتائج

3.1 Patient demographics

Table 1 summarizes the basic characteristics of the 70 patients (NACRT and US groups). In the NACRT group, the median age of the patients was 66 years, and 24 of them (60%) were male. NACRT was performed in three patients with R-PDAC, 35 patients with BR-PDAC, and two patients with LA-PDAC. A pancreatoduodenectomy was performed in 31 patients (79%). The NACRT group had a higher proportion of pretreatment diagnosis for BR- or LA-PDAC (93% vs 53%, ص < .01) and a lower percentage of lymph node metastasis (40% vs 80%, ص < .01) compared with the US group. However, the differentiation status of tumors, tumor size, and proportion of resection margin–negative were similar between the two groups.

مميزات NACRT نحن NACRT vs US
N = 40 N = 30 ص القيمة
Age (y) 66 (51-78) 68 (52-84) .44
Male gender 24 (65%) 16 (53%) .28
Pretreatment diagnosis: R/BR/LA 3 (8%)/35 (88%)/2 (5%) 14 (47%)/16 (53%)/0 <.01
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 4 (10%) 0 .07
ypTS 2.7 (0.9-5.5) 2.9 (1.0-4.3) .14
Nodal metastasis 12 (40%) 24 (80%) <.01
Stage IA/IB/IIA/IIB/III 10 (25%)/17 (43%)/1 (3%)/9 (23%)/3 (8%) 3 (10%)/5 (17%)/0/16 (53%)/6 (20%) .01
Treatment effect, Evans grade I/IIA/IIB/III 9 (19%)/20 (50%)/8 (20%)/3 (8%) - -
Resection margin–negative 34 (85%) 23 (77%) .28
Recurrence 28 (70%) 20 (67%) .77
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced NACRT, neoadjuvant chemoradiotherapy R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy US, upfront surgery.

3.2 Immune cell distribution according to preoperative treatment

As shown in Figure 2, all immune cells were present in both the cancer stroma and the cancer cell nests of PDAC samples. These cells were found to be more abundant in the cancer stroma than in the cancer cell nest regardless of preoperative therapy. Figure 2 shows a comparison of immune cell distributions between the NACRT and US groups. Although the cancer stromal counts of CD4+ T cells, CD20+ B cells, and Foxp3+ T cells in the NACRT group were drastically decreased compared with those in the US group, these counts in the cancer cell nests were not different between the two groups. In contrast, CD204+ macrophage counts in the cancer stroma were similar between the NACRT and US groups, whereas those in the cancer cell nests were significantly reduced in the NACRT group. PD-L1+ carcinoma cell counts in the NACRT group were substantially lower in comparison with the US group (Table 2). These results suggest that alterations in TIICs following NACRT appear to be very different from those in cancer stromal immune cells.

Characteristics (count/mm 2 ) NACRT نحن NACRT vs US
N = 40 N = 30 ص القيمة
CD3+ CD4+ T cell (stroma) 77.5 (13.5-365.7) 92.9 (4.9-397.0) .561
CD3+ CD4+ T cell (cancer cell nest) 9.0 (0.0-82.6) 4.4 (0.0-38.2) .056
CD3+ CD8+ T cell (stroma) 77.3 (17.9-418.8) 139.6 (25.2-684.3) .017
CD3+ CD8+ T cell (cancer cell nest) 16.4 (0.0-173.3) 19.7 (3.5-262.1) .367
CD20+ B cell (stroma) 1.3 (0.0-18.9) 16.5 (0.0-253.4) < .001
CD20+ B cell (cancer cell nest) 0.0 (0.0-11.9) 0.0 (0.0-5.6) .100
CD3+ Foxp3+ T cell (stroma) 4.4 (0.0-73.5) 19.4 (0.1-118.6) .005
CD3+ Foxp3 + T cell (cancer cell nest) 0.5 (0.0-17.0) 1.8 (0.0-17.4) .072
CD204+ cell (stroma) 252.4 (53.0-959.6) 278.6 (2.7-693.8) .302
CD204+ cell (cancer cell nest) 16.7 (0.0-137.6) 56.3 (6.1-150.0) .001
PD-L1 high carcinoma 0.0 (0.0-25.4) 2.2 (0.0-521.3) < .001

3.3 Association between TIICs and early recurrence of disease in the NACRT group

The count of each immune cell found in carcinomas was divided into low and high groups according to the cutoff value (set as the median amount). Kaplan-Meier curve analysis demonstrated that only patients with high CD204+ macrophage counts in the cancer cell nest (>16.7 counts/mm 2 ) had significantly shorter RFS times compared with patients with low CD204+ macrophage counts in the cancer cell nest (Figure 3). Univariate and forest plot analyses suggested that high PD-L1 expression and the presence of CD204+ macrophages in the cancer cell nest were associated with shorter RFS (Table 3 and Figure S2). Following multivariate analysis, only high CD204+ macrophage counts in the cancer cell nest remained an independent predictor of shorter RFS (Table 3). There were no significant differences in the basic characteristics between the groups with high and low CD204+ macrophage counts in the cancer cell nest (Table 4).

Variables Univariate Multivariate
MRFS (months) ص القيمة OR (95% CI) ص-القيمة
CD3+ CD4+ T cell (cancer cell nest) < 9.0 13.5 .360
>9.0 18.7
CD3+ CD8+ T cell (cancer cell nest) < 16.4 15.2 .622
>16.4 12.9
CD20+ B cell (cancer cell nest) < 0.0 15.2 .747
>0.0 6.6
CD3+ Foxp3+ T cell (cancer cell nest) < 0.5 13.5 .667
>0.5 18.7
CD204+ cell (cancer cell nest) < 16.7 25.0 .032 2.366 (1.074-5.215) .033
>16.7 6.9
PD-L1 high carcinoma (cancer cell nest) < 0.0 22.5 .091 2.001 (0.912-4.390) .084
>0.0 6.9
مميزات High CD204+ (cancer cell nest) Low CD204+(cancer cell nest) High vs low
N = 20 N = 20 ص-القيمة
Age (y) 66 (51-78) 66 (54-78) .34
Male gender 14 (70%) 10 (50%) .17
Pretreatment diagnosis: R/BR/LA 2 (10%)/16 (80%)/2 (10%) 1 (5%)/19 (95%)/0 .27
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 2 (10%) 2 (10%) 1.00
ypTS 2.5 (0.9-5.5) 3.0 (1.0-4.0) .51
Nodal metastasis 4 (20%) 8 (40%) .17
Resection margin–negative 3 (15%) 3 (15%) 1.00
Recurrence 16 (80%) 12 (60%) .15
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy ypTS, pathological tumor size.

Tight Control of Hypoxia-inducible Factor-α Transient Dynamics Is Essential for Cell Survival in Hypoxia

Intracellular signaling involving hypoxia-inducible factor (HIF) controls the adaptive responses to hypoxia. There is a growing body of evidence demonstrating that intracellular signals encode temporal information. Thus, the dynamics of protein levels, as well as protein quantity and/or localization, impacts on cell fate. We hypothesized that such temporal encoding has a role in HIF signaling and cell fate decisions triggered by hypoxic conditions. Using live cell imaging in a controlled oxygen environment, we observed transient 3-h pulses of HIF-1α and -2α expression under continuous hypoxia. We postulated that the well described prolyl hydroxylase (PHD) oxygen sensors and HIF negative feedback regulators could be the origin of the pulsatile HIF dynamics. We used iterative mathematical modeling and experimental analysis to scrutinize which parameter of the PHD feedback could control HIF timing and we probed for the functional redundancy between the three main PHD proteins. We identified PHD2 as the main PHD responsible for HIF peak duration. We then demonstrated that this has important consequences, because the transient nature of the HIF pulse prevents cell death by avoiding transcription of p53-dependent pro-apoptotic genes. We have further shown the importance of considering HIF dynamics for coupling mathematical models by using a described HIF-p53 mathematical model. Our results indicate that the tight control of HIF transient dynamics has important functional consequences on the cross-talk with key signaling pathways controlling cell survival, which is likely to impact on HIF targeting strategies for hypoxia-associated diseases such as tumor progression and ischemia.

Author's Choice—Final version full access.

Both authors contributed equally to this work.

Recipient of a Biotechnology and Biological Sciences Research Council doctoral training studentship.

Holds University of Liverpool studentship.

Recipient of a Medical Research Council capacity building studentship.

Present address: Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom.


مقدمة

Skeletal muscles undergo structural and functional adaptations to various stimuli including mechanical (e.g., exercise) and environmental (e.g., systemic hypoxia) stimuli. Endurance exercise training results in improved muscle oxidative capacity (Holloszy and Booth 1976 ), whereas resistance exercise training leads to increases in muscle size and strength (McDonagh and Davies 1984 ). Endurance exercise training (5–6 times/week for 3–6 weeks at 70–80% maximal oxygen uptake) performed in systemic hypoxia induces a greater increase in muscle oxidative capacity when compared to endurance exercise training under normoxia (Desplanches et al. 1993 Geiser et al. 2001 ). This suggests that skeletal muscle adaptations are specific to the type of exercise stimuli, and that the combination of exercise and systemic hypoxia may have a synergistic effect on skeletal muscle adaptations such as muscular endurance.

It is generally recognized that endurance exercise training causes a significant increase in skeletal muscle capillarization, characterized by an elevated capillary density and capillary-to-fiber ratio (Andersen 1975 Brodal et al. 1977 Hudlicka et al. 1992 ). This physiological adaptation contributes to enhanced aerobic capacity via an increase in the transport, conductance, and extraction of oxygen in skeletal muscle. Vascular endothelial growth factor (VEGF) (Folkman and Shing 1992 Hudlicka et al. 1992 van Weel et al. 2004 Olfert et al. 2009 ), the generation of nitric oxide by nitric oxide synthase (NOS) (Baum et al. 2004 , 2013 ), and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (Arany et al. 2008 Leick et al. 2009 ) are positive regulators of angiogenesis in skeletal muscle. Among these regulators, VEGF is known to play a critical role in increasing angiogenesis. When compared with wild-type mice, VEGF transgenic mice (van Weel et al. 2004 ) and muscle-specific VEGF knock-out mice (Olfert et al. 2009 ), respectively, have increased and decreased skeletal muscle capillary density. Both NOS (Baum et al. 2013 ) and PGC-1α (Leick et al. 2009 ) knock-out mice have decreased skeletal muscle VEGF expression and capillary-to-fiber ratio. Acute high-intensity resistance exercise (three sets of 10 repetitions of two legged knee extensor exercise at 60–80% of 1RM) in humans increases the expression of skeletal muscle VEGF mRNA and protein (Gavin et al. 2007 ). Hypoxic stimuli in cells also increase VEGF mRNA levels through the activation of the nuclear transcription factor, hypoxia-inducible factor-1 (HIF-1) (Forsythe et al. 1996 ). Thus, it is possible that resistance exercise training under systemic hypoxia, when compared with normoxia, causes a greater increase in skeletal muscle VEGF and capillarization potentially leading to increased muscular endurance.

Therefore, this study investigated the effects of resistance exercise training under systemic hypoxia on the angiogenic response and muscular endurance in human skeletal muscle. We hypothesized that resistance exercise training under systemic hypoxia would lead to a greater development of muscular endurance and greater increase in angiogenic and mitochondrial responses as demonstrated by increases in VEGF, PGC-1α, NOS, and capillary-to-fiber ratio.


4 EXPERIMENTAL PROCEDURES

4.1 Chick embryos

According to Swedish regulations (Jordbruksverkets föreskrift L150, §5) work on chick embryos younger than embryonic day 13 do not require Institutional Animal Care and Use Committee oversight.

4.2 Human and mouse fetal tissue

Human fetal tissue (ethical approval Dnr 6.1.8-2887/2017, Lund University, Sweden) was obtained from elective abortions. Tissue samples were dissected in custom-made hibernation medium (Life Technologies, Carlsbad, California) and fixed in 4% formaldehyde overnight. Following a sucrose gradient, embryos were embedded in gelatin for transverse sectioning at 12 μm (ew5) or 7 μm (ew6) using a cryostat.

4.3 Cell culture

The human neuroblastoma cell line SK-N-BE(2)c (ATCC Manassas, Virginia) was cultured in MEM supplemented with 10% fetal bovine serum and 100 units penicillin and 10 μg/mL streptomycin. As part of our laboratory routines, all cells were maintained in culture for no more than 30 continuous passages and regularly screened for mycoplasma. SK-N-BE(2)c cells were authenticated by SNP profiling (Multiplexion, Germany).

4.4 Embryos and perturbations

Chick embryos were acquired from commercially purchased fertilized eggs and incubated at 37.5°C until desired developmental Hamburger Hamilton (HH) stages were reached. 10 Optimal conditions for high transfection efficiency applying one-sided electroporation in ovo were determined to 5 pulses of 30 ms each at 22 V. Ringer's balanced salt solution (solution-1:144 g NaCl, 4.5 g CaCl•2H2O, 7.4 g KCl, ddH2O to 500 mL solution-2:4.35 g Na2HPO4•7H2O, 0.4 g KH2ص4, ddH2O to 500 mL [adjust final pH to 7.4]) containing 1% penicillin/streptomycin was used in all experiments. Morpholinos used were from GeneTools with the following sequences splice targeting EPAS1 oligo (5′-GAAAGTGTGAGGGAACAAGTTACCT-3′) and a corresponding 5′-mispair oligo (5′-GAtAcTGTcAGGcAACAAcTTACCT-3′). Morpholinos were injected at a concentration of 1 mM and co-electroporated with a GFP tagged empty control vector (1 μg/μL). RFP-tagged EPAS1 overexpression construct or corresponding empty control vector were electroporated at a concentration of 2.5 μg/μL. CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′ EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc 3′ EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9-GFP (#99138, Addgene) at 2 μg/μL. 40 All constructs were injected at HH stage 10+/11 into the lumen of the neural tube from the posterior end and embryos were electroporated in ovo applying electrodes 4 mm apart, covering the whole embryo. One-sided electroporation was performed to allow for an internal control side within each individual embryo. Embryos were allowed to sit at room temperature for 6 to 10 hours before further incubation of the embryos at 37.5°C in order to allow the Cas9 protein to fold. Importantly, apart for analysis on embryo growth (ie, age determination), all analyses were performed on sections/cells at the trunk axial level of the embryo.

For harvesting of tissue for RNA extraction, embryos were incubated at 37.5°C for 24 (morpholinos and overexpression vectors) or 36 (CRISPR/Cas9) hours postelectroporation. The trunk portion of neural tubes was dissected and immediately snap frozen before RNA extraction and qPCR analysis.

4.5 Cloning

To overexpress HIF-2α, the Gallus gallus EPAS1 coding sequence was amplified using the following primers Fwd:

5′AAACTCGAGGCCACCATGGACTACAAAGACGATGACGACAAGGCAGGTATGACAGCTGACAAGGAGAAG-3′, Rev 5′-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3′ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting, oligos designed to target EPAS1 at three different locations (EPAS1.1, EPAS1.2, and EPAS1.3) were annealed pairwise at a concentration of 100 μM per oligo using T4 DNA Ligase Buffer in dH2O by heating to 95°C for 5 minutes. The annealed oligo reactions were cooled to room temperature and diluted. The U6.3 > gRNA.f + e (#99139, Addgene) vector was digested over night with BsaI-HF enzyme (New England Biolabs) and gel extracted. gRNAs were cloned into the digested U6.3 > gRNA.f + e vector using T4 DNA Ligase (New England Biolabs) at room temperature for 20 minutes. Successful inserts were identified by colony PCR using U6 sequencing primer and gRNA reverse oligo specific to each EPAS1 gRNA.

4.6 Neural tube dissections for crestosphere cultures

Neural tubes from respective axial levels were carefully dissected out from embryos at designated somite stages. For cranial-derived cultures, the very anterior tip was excluded, and the neural tube was dissected until the first somite level as previously described. 26 For trunk-derived cultures, the neural tube was dissected between somite 10 to 15 as previously described. 24, 25 Pools of neural tubes from four to six embryos were used for each culture.

4.7 Crestosphere cell culture

Neural tube derived cells were cultured in NC medium (DMEM with 4.5 g/L glucose (Corning), 7.5% chick embryo extract (MP Biomedicals, Santa Ana,California), 1X B27 (Life Technologies), basic fibroblast growth factor (bFGF, 20 ng/mL) (Peprotech, Stockholm, Sweden), insulin growth factor-I (IGF-I, 20 ng/mL) (Sigma Aldrich, Darmstadt, Germany), retinoic acid (RA 60 nM for cranial and 180 nM for trunk, respectively) (Sigma Aldrich), and 25 ng/mL BMP-4 (for trunk) (Peprotech)) in low-adherence T25 tissue culture flasks as described previously. 24, 25

4.8 Self-renewal assay

Chick embryos at developmental HH stage 10+/11 were injected and electroporated with CRISPR/Cas9 constructs and allowed to develop at 37.5°C to reach HH stage 13 + /14 − . Crestosphere cultures were established from embryos electroporated with control, EPAS1.1 or EPAS1.2 constructs. Crestospheres were dissociated into single cells using Accutase (Sigma Aldrich incubation at 37°C for 40 minutes with 1 minute of pipetting every 10 minutes), and individual cells were manually picked using a p10 pipette tip under a microscope. Single cells were transferred to 96-well plates prepared with 100 μL of NC medium supplemented with RA and BMP-4. 25 The absolute number of spheres formed in each well was quantified manually under the microscope. Sphere diameter was manually measured using the ImageJ software (spheres measured n = 33 and n = 27 for CTRL and EPAS1.2, respectively).

4.9 EdU pulse chase labeling

Proliferation was measured using the Click-iT EdU Cell Proliferation kit (Invitrogen #C10337) according to the manufacturer's recommendations with optimizations from Warren et al. 23 Chick embryos at developmental HH stage 10+/11 were injected and electroporated with morpholino or overexpression constructs and allowed to develop for an additional 24 hours at 37.5°C. Eggs were then reopened and EdU solution (500 μM in PBS-DEPC) was added. Eggs were resealed and incubated at 37.5°C for another 4 hours before dissection in Ringer's solution and fixed in 4% paraformaldehyde overnight. Embryos were washed in PBS-DEPC, H2O, and 3% BSA in PBS-DEPC before permeabilization in 0.5% Triton-X. Embryos were hybridized in reaction cocktail (Click-iT Reaction buffer, CuSO4, Alexa Fluor 488 Azide and reaction buffer additive), washed and DAPI stained. Embryos were after another round of washing processed through a sucrose gradient and embedded in gelatin.

4.10 Whole mount in situ hybridization

For whole mount in situ hybridization, embryos were fixed in 4% PFA and washed in DEPC-PBT. Samples were gradually dehydrated by bringing them to 100% MeOH and kept at −20°C until use. In situ hybridization was performed as previously described. 41 Embryos were rehydrated back to 100% PBT, treated with Proteinase K/PBT, washed in 2 mg/mL glycine/PBT and postfixed in 4% paraformaldehyde/0.2% glutaraldehyde for 20 minutes. Embryos were then prehybridized in hybridization buffer for 2 hours at 70°C and hybridized with Digoxigenin (DIG)-labeled TFAP2B probe overnight at 70°C. Embryos were washed in wash solutions I and II (50% formamide, 1% sodium dodecyl sulfate [SDS] and 5X SSC [NaCl and Na citrate] or 2X SSC, respectively), and blocked in 10% sheep serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST/1% sheep serum overnight at 4°C. On day 3, embryos were washed in TBST throughout the day and overnight. Embryos were washed in alkaline phosphatase buffer (NTMT 100 mM NaCl, 100 mM Tris-Cl [pH 9.5], 50 mM MgCl2, 1%Tween-20) before visualizing the signal using NBT/BCIP (Sigma Aldrich). Stained embryos were rinsed in PBT for 20 minutes and postfixed in 4% PFA/ 0.1% glutaraldehyde overnight when considered complete. Embryos were then dehydrated in MeOH to be stored at −20°C. Embryos were later embedded in blocks of gelatin for transverse sectioning at 8 μm using a cryostat. Hybridization probe for avian TFAP2B was a kind gift from Dr Felipe Vieceli.

4.11 RNA sequencing

Chick embryos of stage HH10+/11 were from the posterior end injected with EPAS1 targeting or corresponding 5′-mispair morpholinos into the lumen of neural tubes and subsequently electroporated for construct uptake. Following 24 hours of incubation at 37.5°C, embryos were removed from the eggs in Ringer's solution. The neural tube portion at the trunk axial level of individual embryos were carefully dissected, removing surrounding mesodermal tissue, and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen. RNA was extracted from each individual neural tube (five samples per condition [EPAS1 and 5′-mispair, respectively]) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina). Alignment of reads was performed using the HISAT2 software and the reference genome was from the Ensemble database (جالوس جالوس 5.0). Expression counts were performed using the StringTie software and DEG analysis was performed using DESeq2. To obtain a relevant working list out of the 1105 significantly DEGs, we set a cut-off at ص < .005 and removed all hits that were NA, ending up with 97 genes. الدلالة (ص values) was DESeq2 derived. 42 RNA sequencing data have been deposited in NCBI's Gene Expression Omnibus 43 and are accessible through GEO Series accession number GSE140319.

4.12 Bioinformatics

GSEA for gene ontology, network and functional analyses were generated through the use of Panther database (analyses performed autumn 2018 (http://pantherdb.org/) 44 together with the Ingenuity Pathway Analysis (IPA) software 45 (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis). For a hypothesis-free/exploratory analysis of the 97 DEGs, IPA was used (ص-value calculations using right-tailed Fisher Exact Test). IPA was mainly used for deeper exploration of the data where the biological hypotheses generated for the project were further explored. Here, a hypotheses-driven approach was taken where the following categories found from the IPA analysis of the 97 DEGs were further investigated “Cellular Movement,” within the “Molecular and Cellular Function” result category, “Embryonic Development,” within the category “Physiological System Development and Function,” and “Tumor Morphology,” within the “Disease and Disorders” category. These three biological networks were further investigated within the data set at hand. The investigation for the possible overlap and connections between these networks in the context of the data were hence explored.

4.13 Cryosections

Fixed embryos were incubated in a sucrose gradient (5% sucrose for 10 minutes and 15% sucrose for 10 minutes up to several hours) followed by incubation in 7.5% gelatin over night at 37°C. Gelatin embedded samples were cryosectioned at 7 to 20 μm.

4.14 Immunohistochemistry and immunofluorescence

Immunohistochemistry on mouse fetal tissue for HIF-2α (NB100-132, Novus Biologicals) and TH (ab112, Abcam) was performed using Autostainer (Dako). Sections were counterstained with hematoxylin. Detection of HIF-2α by immunofluorescence was performed on sections from the trunk axial level of embryos (avian and human) that had been harvested, fixed as whole embryos in 4% PFA overnight, incubated in 5% sucrose for 10 minutes, 15% sucrose for 4 hours and gelatin overnight. Embryos were then embedded in gelatin and snap frozen. Dry embryo sections were incubated in ice-cold acetone followed by 0.3% Triton-X in PBS. After washing in PBS, slides were blocked in DAKO serum-free ready-to-use block (DAKO, #X0909) for 1 hour before incubation with primary antibodies (in DAKO antibody diluent with background reducing components [DAKO, #S3022]) overnight (HIF-2α, ab199, Abcam HNK-1, 3H5, DSHB). Slides were washed in PBS and incubated with rabbit linker (DAKO, #K8019) followed by secondary antibody in 1% BSA/PBS. Detection of HNK1 and SOX9 by immunofluorescence was performed by blocking (10% goat serum and 0.3% Triton-X in TBST) of embryo sections followed by incubation with primary antibodies (SOX9, ab5535, Millipore) over night at +4°C. Slides were washed and incubated with secondary antibodies and DAPI for nuclear staining for 1 hour at RT before washing and mounting. Fluorescent images were acquired using an Olympus BX63 microscope, DP80 camera, and cellSens Dimension v 1.12 software (Olympus Cooperation). Detailed information on antibodies can be found in Table 6.

صنف تخفيف مصدر Product #
IF antibodies
Primary antibody
HNK1 الفأر 1:5 Hybridoma bank 3H5
HIF-2α أرنب 1:50 Abcam ab199
SOX9 أرنب 1:1000 Millipore ab5535
Secondary antibody
Anti-mouse Alexa Fluor-594 ماعز 1:1000 إنفيتروجين A-11032
Anti-rabbit Alexa Fluor-546 حمار 1:1000/1:500 إنفيتروجين A-10040
Anti-mouse Alexa Fluor-488 ماعز 1:1000 إنفيتروجين A-11008
IHC antibodies
Primary antibody
HIF-2α الفأر 1:1000 Novus Biologicals NB100-132
HIF-2α أرنب 1:4000 Abcam ab199
ذ أرنب 1:1600 Abcam ab112
In situ antibodies
Anti-dig-AP الفأر 1:2000 Roche Diagnostics 11 093 274 910
Nuclear staining
DAPI 1:3000 Dako D3571
Western blot antibodies
Primary antibody
HIF-2α أرنب 1:200 Abcam ab199
SDHA الفأر 1:4000 Abcam ab14715
Secondary antibody
Anti-rabbit قرد 1:3000 إنفيتروجين 65-6120
Anti-mouse خروف 1:5000 إنفيتروجين 62-6520

4.15 Western blot

Extracted proteins were separated by SDS-PAGE, transferred to HyBond-C-Extra nitrocellulose membranes, blocked, and incubated with primary antibodies (HIF-2α, ab199, Abcam SDHA, ab14715, Abcam) at 4°C overnight. The next day, membranes were incubated with HRP-conjugated antibodies and proteins detected by ECL solution. Detailed information on antibodies can be found in Table 6.

4.16 RNA extraction and quantitative real-time PCR

Total RNA was extracted using the RNAqueous Micro Kit (Ambion, #AM1931). cDNA synthesis using random primers and qRT-PCR was performed as previously described. 27 Relative mRNA levels were normalized to expression of two reference genes (18 ثانية, 28 ثانية) using the comparative Ct method. 46 Detailed information of primer sequences can be found in Table 7.

Target gene 5′-3′
18 ثانية (reference gene) Fwd CCATGATTAAGAGGGACGGC
القس TGGCAAATGCTTTCGCTTT
28 ثانية (reference gene) Fwd GGTATGGGCCCGACGCT
القس CCGATGCCGACGCTCAT
EPAS1 Fwd GGCACCAATACCATGACGA
القس CATGTGCGCGTAACTGTCC
SOX10 Fwd AGCCAGCAATTGAGAAGAAGG
القس GAGGTGCGAAGAGTTGTCC
B3GAT1 Fwd TTGTGGAGGTGGTGAGGA
القس GGCTGTAGGTGGGTGTAATG
TFAP2B Fwd CCCTCCAAAATCCGTTACTT
القس GGGGACAGAGCAGAACACCT
HOXC9 Fwd TAAGCCACGAAAACGAAGAG
القس GAAGGAAAGTCGGCACAGTC
HOXA2 Fwd AGGCAAGTGAAGGTCTGGTT
القس TCGCCGTTCTGGTTCTCC
NGFR Fwd AGCAGGAGGAGGTGGAGAA
القس CCCGTGTGAAGCAGTCTATG
HES6 Fwd GCTGATGGCTGATTCCAAAG
القس TCGCAGGTGAGGAGAAGGT
AGPAT4 Fwd TGCTGGGCGTTCTAAATGG
القس ACACTCCTGCTCATCTTCTGG
HES5 Fwd GTATGCCTGGTGCCTCAAA
القس GCTTGTGACCTCTGGAAATG
RASL11B Fwd GCTGGGCTGTGCTTTCTATG
القس GGTGCTGGTGGTCTGTTGTT
FMN2 Fwd CCATCAGCCAGTCAAGAGGA
القس TAAAGCATCGGGAGCCAAAC
TAGLN3 Fwd AGGCAGCATTTCCAGACC
القس ATGGGTTCGTTTCCCTTTG
NRCAM Fwd TCATTCCGTGTGATTGCTGT
القس AAGGATTTTCATCGGGGTTT
EGFP Fwd CCGACCACTACCAGCAGAAC
القس TTGGGGTCTTTGCTCAGG

4.17 RNAi experiments

SK-N-BE(2)c cells were transfected with ON-TARGETplus Nontargeting Control siRNA #2 (D-001810-02-05), ON-TARGETplus siRNA Targeting human HIF1Α (J-004018-07) or ON-TARGETplus siRNA Targeting human EPAS1 (J-004814-06), all from Dharmacon, using Lipofectamine 2000 or RNAiMAX. Cells were then placed in 21% or 1% oxygen for 48 hours before harvest. SK-N-BE(2)c cells were treated with 200 μM 2,2′-dipyridyl (DIP), an iron chelator that promotes stabilization of HIF-α at normoxic conditions for 4 hours before harvest and were used as positive control for western blot detection of HIF-2α.

4.18 Oxygen sensing

Oxygen concentrations were measured through the trunk region of developing chick embryos ex ovo within 30 minutes from dissection using microsensors in a flow system of MQ water. We performed trials to confirm that oxygen concentrations are largely stable within the tissue ex ovo over at least 5 hours. Microprofiles were measured in 50 embryos in developmental stages HH10 to HH24. Embryos were removed from the egg using filter paper as described in Mohlin and Kerosuo, 24 submerged in a plate with constant flow of newly shaken MQ of room temperature, and immediately measured. Oxygen microsensors were constructed and calibrated as described by Revsbech and Andersen, 47 mounted on a micromanipulator. The microsensor was manually probing the trunk region and data logged every second. Within the microprofile, 10 consecutive data points of the lowest oxygen concentrations were averaged and set as representing the trunk neural tube. A two-point calibration was performed using the newly shaken MQ (100% oxygen saturation) and by adding sodium dithionite to nonflowing MQ in the plate after measurements (0% oxygen saturation). Salinity of the tissue was determined using a conductivity meter (WTW 3110) and room temperature noted. The tissue is considered a liquid, where full oxygen saturation at 5‰ salinity and 25°C corresponds to 250 μm/L, 160 mmHg, or 21% atmospheric O2. Data were averaged for each HH stage including one measurement of the previous and subsequent HH stages. Replicates vary from 3 to 10 biologically independent data points. Data are presented as percent of maximum saturation in the solution of the specific temperature and salinity.

4.19 Quantifications

Embryonic development was quantified in two ways by determining the HH stage of embryos in ovo using head and tail morphology or by counting the number of somites of dissected embryos ex ovo. The number of embryos (n) for each group is denoted in respective figure legend. The fraction of proliferating EdU + cells was determined by quantifying the number of GFP + proliferating cells as well as RFP + construct targeted cells and dividing the number of double positive cells with the number of RFP + only cells. Premigratory and recently delaminated trunk neural crest cells were included (distinguished by the dotted line in figures). Quantification of migration was performed by calculating the area of detected HNK1 using the ImageJ software. The area of HNK1+ on the electroporated side of the embryos was normalized to that of the control side of the same embryo.

4.20 Statistical methods and data sets

One-way analysis of variance or two-sided student's unpaired ر test was used for statistical analyses. For downstream analysis on the 97 DEGs where the software IPA was used, the statistical tests considered were ص-value calculations using right-tailed Fisher exact test.


مقدمة

In the early 20th century, after extensive studies of the ovine fetal circulation, Sir Joseph Barcroft (1872-1947) postulated that the environment in which the human fetus develops would be comparable to that likely endured by an adult on the summit of Mount Everest [1, 2]. He termed this intriguing hypothesis 'Everest in utero' and proposed that to survive the hypoxic uterine environ ment the fetus must develop elaborate physiological strategies comparable to those seen in climbers ascending the great Himalayan peaks.

In 2007, four climbers descending from the summit of Mount Everest (8,848 meters) took arterial blood gases from one another at 8,400 meters above sea level. Their mean arterial partial pressure of oxygen (PaO2) was 3.28 kPa (24.6 mm Hg) with a mean calculated arterial oxygen saturation (SaO2) of 54% while they rested without supplemental oxygen [3]. Among this group, one individual had a PaO2 of 2.55 kPa (19.1 mm Hg), the lowest PaO2 ever reported in an adult human. So how far removed from intrauterine life were these measurements, and do climbers exhibit, as does the fetus, physiological strategies that may benefit the similarly hypoxemic critically ill patient?


Nanoparticles for Targeting Intratumoral Hypoxia: Exploiting a Potential Weakness of Glioblastoma

Extensive hypoxic regions are the daunting hallmark of glioblastoma, as they host aggressive stem-like cells, hinder drug delivery and shield cancer cells from the effects of radiotherapy. Nanotechnology could address most of these issues, as it employs nanoparticles (NPs) carrying drugs that selectively accumulate and achieve controlled drug release in tumor tissues. Methods overcoming the stiff interstitium and scarce vascularity within hypoxic zones include the incorporation of collagenases to degrade the collagen-rich tumor extracellular matrix, the use of multistage systems that progressively reduce NP size or of NP-loaded cells that display inherent hypoxia-targeting abilities. The unfavorable hypoxia-induced low pH could be converted into a therapeutical advantage by pH-responsive NPs or multilayer NPs, while overexpressed markers of hypoxic cells could be specifically targeted for an enhanced preferential drug delivery. Finally, promising new gene therapeutics could also be incorporated into nanovehicles, which could lead to silencing of hypoxia-specific genes that are overexpressed in cancer cells. In this review, we highlight NPs which have shown promising results in targeting cancer hypoxia and we discuss their applicability in glioblastoma, as well as possible limitations. Novel research directions in this field are also considered.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


شاهد الفيديو: شاب يقوم بفضح مافيا لاستراد مكثفات الاكسجين وكيف يخدعون ألشعب الجزائري (قد 2022).


تعليقات:

  1. Zohar

    هذا مثير للاهتمام. قل من فضلك - أين يمكنني أن أقرأ عن هذا؟

  2. Tangakwunu

    إنها رسالة رائعة ومفيدة إلى حد ما

  3. Tau

    إنها الإجابة القيمة

  4. Drake

    انت لست على حق. أنا متأكد. يمكنني إثبات ذلك. اكتب في PM ، وسوف نتواصل.

  5. Demason

    في نظري انه أمر واضح. لقد وجدت إجابة سؤالك في google.com

  6. Tu

    هذه الرسالة لا تضاهى ،)) ، أحب :)

  7. Zujora

    أعتذر ، لكن في رأيي ، من الواضح.



اكتب رسالة