معلومة

2.6: Endoreduplication - علم الأحياء

2.6: Endoreduplication - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Endoreduplication، هو نوع خاص من تضخيم الجينوم الخاص بالأنسجة والذي يحدث في العديد من أنواع الخلايا النباتية وفي الخلايا المتخصصة لبعض الحيوانات بما في ذلك البشر. مثال على ذلك هو مكرر للغاية الغدة اللعابية بوليتين كروموسومات D. melanogaster (الشكل ( PageIndex {21} )) والتي يمكن أن تحتوي على أكثر من 1000 كروماتيد تتماشى مع بعضها وتشكل كروموسومات عملاقة تظهر نمط النطاقات الذي يعكس تسلسل الحمض النووي الأساسي والجينات في منطقة الكروموسوم هذه. كانت هذه الكروموسومات نماذج بحثية رائعة في علم الوراثة ، نظرًا لأن حجمها الكبير نسبيًا والمضخم يجعل من السهل تحديد ودراسة مجموعة واسعة من انحرافات الكروموسومات تحت المجهر.

الشكل ( PageIndex {21} ): الكروموسومات المضاعفة من خلية الغدة اللعابية ذبابة الفاكهة. يتم إنتاج نمط النطاقات بملصقات الفلورسنت (Flickr-Elissa Lei ، Ph.D. @ NIH-CCA)


2.6: Endoreduplication - علم الأحياء

أولاً ، كان مجال أبحاثه هو علم الوراثة الخلوية للنبات ، وخاصة فيما يتعلق بتكرار الحمض النووي ودورة الخلية. كانت التبادلات الكروماتيدية الشقيقة وانحرافات الكروموسومات هي نقاط النهاية المفضلة. بعد إقامة لمدة ست سنوات في إجراء بحث في مجلس البحوث الإسباني (مدريد) ، انتقل في عام 1980 إلى جامعة إشبيلية ، حيث أنشأ فريق بحث خاص به مهتمًا بتلف الحمض النووي الناجم عن المطفرات البيئية المختلفة بالإضافة إلى آليات الخلية التي تتعامل مع مثل هذا الضرر. بينما كانت الخلايا النباتية حتى عام 1985 هي المادة المستخدمة بشكل حصري تقريبًا ، انتقل في ذلك العام إلى جامعة أوبسالا (السويد) ، ثم انتقل لاحقًا إلى جامعة سان فرانسيسكو في كاليفورنيا (الولايات المتحدة الأمريكية) للتعرف على منهجيات زراعة الخلايا المختبرية لخلايا الثدييات والبشر.

هو & مدير فريق البحث خلية الثقافة وعلم الأحياء الإشعاعي الذي يلتزم المختبر في كلية الأحياء في إشبيلية (إسبانيا) بالتحديث المستمر للأهداف والمنهجيات نتيجة للاتصالات مع العلماء في جميع أنحاء العالم وكذلك التعاون والتبادلات مع المختبرات الأخرى . حتى الآن ، كانت مجالات أبحاثهم الرئيسية باستخدام خلايا الثدييات المستزرعة هي: دراسات الحماية من الإشعاع التي أجريت في إطار المشاريع المنسقة للاتحاد الأوروبي ، والآليات المشاركة في الانحرافات الصبغية وتبادل الكروماتيدات الشقيقة (للكشف عن تلف الحمض النووي) ، والمشاركة المحتملة من الإنزيمات النووية المختلفة (بشكل رئيسي DNA topoisomerases I و II) في إصلاح الحمض النووي التالف ، والأضرار السامة للجينات في الطيور في منتزه Do & ntildeana الوطني (جنوب غرب إسبانيا) في أعقاب تسرب النفايات السامة للتعدين إلى نهر Guadiamar ، ومن بين أمور أخرى ، المقايسات من المستخلصات النباتية الأندلسية والأمريكية اللاتينية فيما يتعلق بنشاطها المحتمل المضاد للأورام. الدكتور F.Cort & eacutes هو مؤلف لثلاثة كتب مدرسية عن علم الأنسجة النباتية ، وهو عضو في هيئة تحرير أبحاث الطفرات (Elsevier).

كانيرو جي ، كامبانيلا سي ، ماتيوس إس ، كورتيس إف.
تثبيط Topoisomerase II وعائد مرتفع من التكرار الداخلي الناجم عن مركبات الفلافونويد luteolin و quercetin.
الطفرات. 2006 21 سبتمبر (5): 321-5. Epub 2006 1 سبتمبر.
PMID: 16950806 [PubMed - مفهرس لـ MEDLINE] ------

كانترو جي ، باستور إن ، ماتيوس إس ، كامبانيلا سي ، كورتيس إف.
المضاعفة الداخلية التي يسببها سيسبلاتين في خلايا CHO: تلف الحمض النووي وتثبيط توبويزوميراز II.
موتات ريس. 2006 يوليو 25599 (1-2): 160-6. Epub 2006 30 مارس.
PMID: 16574165 [PubMed - مفهرس لـ MEDLINE] ------

ماتيوس إس ، حاجي إن ، القس إن ، كورتيس ف.
تعديل الاستجابة الإشعاعية عن طريق تثبيط النشاط التحفيزي للتوبوإيزوميراز II.
موتات ريس. 2006 يوليو 25599 (1-2): 105-15. Epub 2006 30 مارس.
PMID: 16574164 [PubMed - مفهرس لـ MEDLINE] ------

Cantero G ، Mateos S ، Pastor N ، Cortes F.
يحمي استبدال الهالوجين للحمض النووي من تسمم توبويزوميراز II الذي ينتج عنه انكسارات الحمض النووي المزدوجة.
إصلاح الحمض النووي (أمست). 2006 يونيو 105 (6): 667-74. Epub 2006 10 يناير.
PMID: 16406738 [PubMed - مفهرس لـ MEDLINE] ------

Lopez-Lazaro M ، Pastor N ، Azrak SS ، Ayuso MJ ، Cortes F ، أوستن CA.
الديجيتوكسين ، بتركيزات شائعة في بلازما مرضى القلب ، يعاكس نشاط الإيتوبوزيد والإيداروبيسين في خلايا سرطان الدم K562.
لوك ريس. 2006 30 يوليو (7): 895-8. Epub 2006 4 يناير.
PMID: 16387358 [PubMed - قيد المعالجة] ------

Lopez-Lazaro M، Pastor N، Azrak SS، Ayuso MJ، Austin CA، Cortes F.
يمنع الديجيتوكسين نمو خطوط الخلايا السرطانية بتركيزات شائعة في مرضى القلب.
J نات برود. 2005 نوفمبر 68 (11): 1642-5.
PMID: 16309315 [PubMed - مفهرس لـ MEDLINE]

كورت وإيكوتيس بينافيدس ، فيليبي
لا ناتوراليزا ديل إيه دي إن. تحديد الفصل الصحيح و oacuten de los cromosomas في الانقسام
Investigaci & oacuten y Ciencia، Junio ​​2005، pag 35-36. ------

ماتيوس إس ، دوم ، إياكوتينجويز الأول ، باستور إن ، كانترو جي ، كورتيس إف.
يؤدي إزالة الميثيل 5-azaC من الحمض النووي إلى حدوث مضاعفة في خلايا الهامستر الصينية المستزرعة.
موتات ريس. 2005 أكتوبر 15578 (1-2): 33-42. Epub 2005 23 مارس.
PMID: 16202795 [PubMed - مفهرس لـ MEDLINE]] ------

حاجي إن ، ماتيوس إس ، باستور إن ، دومينغيز الأول ، كورتيس ف.
تحريض الضرر السام للجينات والسمية للخلايا بواسطة aclarubicin ، مثبط ثنائي توبويزوميراز.
موتات ريس. 2005 مايو 2583 (1): 26-35.
PMID: 15866463 [PubMed - مفهرس لـ MEDLINE] ------

باستور ن ، كانترو جي ، كامبانيلا سي ، كورتيس ف.
المضاعفة المستحثة في خلايا الهامستر الصينية المستزرعة بواسطة مواد كيميائية مختلفة من مضادات توبويزوميراز II. دليل على المساهمة الأساسية للإنزيم في فصل الكروموسوم.
موتات ريس. 2005 أبريل 4582 (1-2): 11-9. Epub 2005 24 يناير.
PMID: 15781205 [PubMed - مفهرس لـ MEDLINE] ------

كورتيس إف ، ماتيوس إس ، باستور إن ، دومينجيز آي.
نحو نموذج شامل للتكرار الداخلي المستحث.
علوم الحياة. 2004 نوفمبر 2676 (2): 121-35. إعادة النظر.
PMID: 15519359 [PubMed - مفهرس لـ MEDLINE] ------

حاجي إن ، باستور إن ، ماتيوس إس ، دومينغيز الأول ، كورتيس ف.
تكسر خيوط الحمض النووي التي يسببها مضاد توبويزوميراز II ثنائي ديوكسوبيبرازين ICRF-193.
موتات ريس. 2003 سبتمبر 29530 (1-2): 35-46.
PMID: 14563529 [PubMed - مفهرس لـ MEDLINE] ------

Cortes F، Pastor N، Mateos S، Dominguez I.
تلعب طبيعة الحمض النووي دورًا في فصل الكروموسوم: التكرار الداخلي في الكروموسومات المستبدلة بالهالوجين.
إصلاح الحمض النووي (أمست). 2003 يونيو 112 (6): 719-26.
PMID: 12767350 [PubMed - مفهرس لـ MEDLINE] ------

القس ن ، خوسيه فلوريس إم ، دومينجيز الأول ، ماتيوس إس ، كورتيس ف.
إنتاجية عالية من التكرار الداخلي الناجم عن ICRF-193: مثبط تحفيزي توبويزوميراز II.
موتات ريس. 2002 أبريل 26516 (1-2): 113-20.
PMID: 11943617 [PubMed - مفهرس لـ MEDLINE] ------

القس N ، دومينغيز الأول ، ماتيوس S ، كورتيس ف.
دراسة مقارنة للتأثيرات السامة للجينات للأدوية المضادة لتوبويزوميراز II ICRF-193 والبوفالين في خلايا مبيض الهامستر الصيني.
موتات ريس. 2002 مارس 25515 (1-2): 171-80.
PMID: 11909765 [PubMed - مفهرس لـ MEDLINE] ------

دومينغيز الأول ، باستور إن ، ماتيوس إس ، كورتيس ف.
اختبار آلية SCE باستخدام مثبطات توبويزوميراز II غير المسمومة.
موتات ريس. 2001 أكتوبر 18497 (1-2): 71-9.
PMID: 11525909 [PubMed - مفهرس لـ MEDLINE] ------

دومينغيز الأول ، ماتيوس إس ، كورتيس ف.
مقالات ذات صلة ، روابط
محصول SCEs والانتقالات التي ينتجها 3 aminobenzamide في خلايا الهامستر الصينية المستزرعة.
موتات ريس. 2000 مارس 14448 (1): 29-34.
PMID: 10751620 [PubMed - مفهرس لـ MEDLINE] ------


2.6: Endoreduplication - علم الأحياء

Endoreduplication، هو نوع خاص من تضخيم الجينوم الخاص بالأنسجة والذي يحدث في العديد من أنواع الخلايا النباتية وفي الخلايا المتخصصة لبعض الحيوانات بما في ذلك البشر. لا يؤثر التكرار الداخلي على السلالة الجرثومية أو الأمشاج ، لذلك لا تعتبر الأنواع ذات التكرار الداخلي متعدد الصيغ الصبغية. يحدث التكرار الداخلي عندما تخضع الخلية لجولات إضافية من تخليق الحمض النووي (المرحلة S) دون أي انقسام أو انقسام خلوي لإنتاج خلية ذاتية الصبغية. هذا ينتج كروماتيدات متعددة لكل كروموسوم. يبدو أن endopolyploidy مرتبطة بالخلايا النشطة جدًا في التمثيل الغذائي ، وتنتج الكثير من الإنزيمات والبروتينات الأخرى في فترة زمنية قصيرة. مثال على ذلك هو الغدة اللعابية المضاعفة للغاية بوليتين كروموسومات D. melanogaster (الشكل 2.17) والتي يمكن أن تحتوي على أكثر من 1000 كروماتيد تتماشى معًا وتشكل نمط نطاقات فريد يعكس تسلسل الحمض النووي والجينات في منطقة الكروموسوم هذه. كانت هذه الكروموسومات نماذج بحثية مفيدة في علم الوراثة ، نظرًا لأن حجمها الكبير نسبيًا يجعل من السهل تحديد ودراسة انحرافات الكروموسومات تحت المجهر.

برنامج CuboCube مفتوح المصدر. الكود المصدري متاح في مستودع Github العام الخاص بنا.


الملخص

تحسنت النتائج بالنسبة لغالبية مرضى المايلوما خلال العقود الأخيرة ، مدفوعة بالتقدم في العلاج. ومع ذلك ، هناك مجموعة فرعية من المرضى الذين تم اعتبارهم مصابين بمرض شديد الخطورة ولم يستفدوا. إن فهم كيفية تطور المرض عالي الخطورة من مراحل أكثر قابلية للعلاج هو أمر بالغ الأهمية إذا أردنا تحسين النتائج. يمكن تحقيق ذلك من خلال تحديد الآليات الجينية والطفرات التي تدفع عملية انتقال خلية بلازما طبيعية إلى خلية أخرى مع سمات مراحل المرض التالية: الاعتلال الجامائي وحيد النسيلة ذو الأهمية غير المحددة ، والورم النخاعي المشتعل ، والورم النخاعي ، وابيضاض الدم في خلايا البلازما. على الرغم من أن الأحداث البادئة للورم النخاعي هي نسيلي ، إلا أن آفات المحرك اللاحقة تحدث غالبًا في مجموعة فرعية من الخلايا ، مما يسهل التقدم من خلال عمليات الانتقاء الداروينية. سيكون فهم التطور المشترك للحيوانات المستنسخة داخل بيئتها المكروية أمرًا بالغ الأهمية للتلاعب العلاجي بالعملية. المرحلة النهائية من التقدم هي توليد حالة مرتبطة بمقاومة العلاج وزيادة الانتشار وتجنب موت الخلايا المبرمج والقدرة على النمو بشكل مستقل عن البيئة المكروية لنخاع العظام. في هذه المراجعة ، نناقش حالات المرض عالية الخطورة في المرحلة النهائية وكيف تعمل المعلومات الجديدة على تحسين فهمنا لمساراتها التطورية ، وكيف يمكن تشخيصها والسلوك البيولوجي الذي يجب معالجته إذا كان يجب معالجتها بشكل فعال.


3. متى تم اكتشاف JAs ودورها كهرمونات؟

في عام 1899 ، قام هيس ومولر بتنقية كيتون غير معروف من ياسمينوم غرانديفلوروم مستخلصات الزيت العطري وتسمى بالياسمين [13]. تم حل تركيبته الكيميائية في عام 1933 بواسطة Ruzicka و Pfeiffer [14]. ومع ذلك ، يتم أيضًا عزل الياسمين المنقى ، جنبًا إلى جنب مع المركبات المعروفة الأخرى ياسمينوم لا يحتوي الزيت العطري على الرائحة المميزة لزهور الياسمين ، مما يشير إلى فقد مكون واحد أو أكثر. في عام 1962 ، تم عزل ميثيل جاسمونيت في النهاية وتم تحديد بنيته ، وتبين أنه جزيء الرائحة المفقود [15]. استغرق الأمر 20 عامًا أخرى قبل أن يلاحظ علماء الأحياء أن JAs لها تأثيرات على شيخوخة الأوراق ونمو الشتلات [16 ، 17]. كان تحديد مسار التخليق الحيوي JA قد اكتمل بالفعل في عام 1992 [18] ، بينما كان الأول A. thaliana متحولة مقاومة JA ، coi1 (بالنسبة لحساسية الكورونات 1) ، تم عزله عام 1994 [19]. تم استنساخ الجين في عام 1998 [20] وتم تحديده رسميًا على أنه مستقبل JA الوحيد (حتى الآن) بعد 11 عامًا [21 ، 22].


المواد والأساليب

تعطيل موضع XRCC3 في HCT116

تم إدخال جينات مقاومة للأدوية غير محفزة في Exon 3 في الإطار. تم تضخيم عنصر استهداف 1.5 كيلو بايت 5 من الحمض النووي متساوي المنشأ لخلايا HCT116 باستخدام I1-1 (5′-TGCGAGGTTCATACTCC-3) و E3-2A (5′-GCATCGATGCAAATCCATTTTGTCGG-3). تم تضخيم عنصر استهداف 3.0 كيلو بايت 3 باستخدام E3-1 (5′-TACTGGACCTGAATCCCAGA-3) و I4-1 (5′-ATGGAAACCTTGTCCGTCCA-3). تم استنساخ كلا العنصرين في pCR2.1 (Invitrogen) بواسطة طريقة استنساخ TA. تم قطع العنصر 3 Kpnأنا الهضم واستنساخ Kpnأنا موقع في المتجه الذي يحتوي على عنصر 5. تم تضخيم شريط مقاومة النيوميسين من pMC1neo-polyA (ستراتاجين) باستخدام Cla4neo1 (5′-CTATCGATGTATGGGATCGCCATT-3 ′) و neo8cla2 (5′-TCATCGATGAAGCTTGCTGCAGGT-3 ′). تم تضخيم شريط مقاومة hygromycin من pcDNA / Hygro (Invitrogen) باستخدام كلاI-hyg (5′-CTATCGATGTATGAAAAAGCCT-3 ′) و hyg-كلاأنا (5′-TCATCGATGAGGCTTTACACTTT-3 ′). تم إدخال كاسيت مقاومة الأدوية في كلاأنا موقع المتجه الذي يحتوي على كلا العنصرين في الإطار. تم وصف طريقة لتجارب خروج المغلوب في HCT116 (Miyagawa وآخرون، 2002). تم الحصول على الجسم المضاد لـ XRCC3 من Chemicon.

التعبير عن جين XRCC3

الانسان XRCC3 تم تضخيم cDNAs من cDNA المستمدة من الدم الطبيعي باستخدام E3-5 (5′-CCTCCCACAGGCTTTGAATT-3 ′) و 3 UTR-1 (5′-GAAGAGCTGTGTCTGAACCA-3). تم إدخال cDNAs في pCR2.1 ، وتم تأكيد التسلسل. ال XRCC3 تم إدخال cDNAs المصب لمُحسِّن MSV ومروج MMTV. تم نقل الخلايا التي تعاني من نقص XRCC3 مع النواقل وتم اختيارها في وجود 900 ميكروغرام / مل من زيوسين (Invitrogen). تم إجراء التعبير المفرط لـ XRCC3 في خلايا RPA-overexpressing باستخدام نفس المتجهات و pKO SelectPuro (معجم الوراثة) ، لأن خلايا RPA-overexpressing قد تم نقلها بالفعل بجينات مقاومة Zeocin. تم عزل خلايا XRCC3-overexpressing بواسطة PCR باستخدام بادئات خاصة بناقلات التعبير.

معدل النمو والحساسية للعوامل الضارة بالحمض النووي

عولجت الخلايا باستخدام MMC (Kyowa-Hakko) في التعليق لمدة 10 دقائق ، وغسلها بمحلول ملحي مخزّن من الفوسفات (PBS) مرتين ، وطلي بكثافة 2 × 10 3 خلايا لكل طبق 60 مم. بعد 7 أيام من الثقافة ، تم عد المستعمرات. تم قياس الحساسية للإشعاع المؤين ومعدل النمو كما هو موصوف (Miyagawa وآخرون, 2002 ).

قياس ترددات إعادة التركيب المتماثل وتشكيل تركيز Rad51

طرق قياس مستويات SCE وتردد التكامل المستهدف في RAD54B تم وصف المكان ، وذلك لـ RAD51C تم تعديل الموضع (Miyagawa وآخرون، 2002). لتحسين وتيرة الاستهداف في RAD51C الموضعية ، تم تضخيم عناصر الاستهداف 5 ′ و 3 من الحمض النووي المتساوي. تم فحص تشكيل تركيز Rad51 كما هو موضح سابقًا (Tashiro وآخرون, 2000 ).

تحليل FISH

تم الحصول على المجسات المركزية الخاصة بالكروموسوم من Vysis. تم تغيير طبيعة الحمض النووي في الخلايا في 70 ٪ فورماميد / 2 × SSC عند 72 درجة مئوية لمدة 1.5 دقيقة. تم إجراء التهجين في CEP Hybridization Buffer (Vysis) عند 37 درجة مئوية لمدة 48 ساعة. تم غسل الشرائح في 50٪ فورماميد / 2 × SSC عند 45 درجة مئوية لمدة 5 دقائق مرتين وفي 2 × SSC عند 45 درجة مئوية لمدة 5 دقائق مرتين. كان الحمض النووي الخلوي ملطخًا بـ DAPI.

تحليل دورة الخلية

لقياس مؤشر الانقسام الفتيلي ، تمت إضافة نوكودازول إلى وسط المزرعة إلى تركيز نهائي قدره 200 نانوغرام / مل. تم حصاد الخلايا على فترات زمنية 6 ساعات ، وتم تثبيتها في 70 ٪ من الإيثانول وملطخة بـ Hoechst 33258. لقياس محتوى الحمض النووي ، تم أخذ الخلايا المزروعة في وجود 100 نانوغرام / مل من نوكودازول في النقاط الزمنية المحددة ، وغسلها ثلاث مرات باستخدام PBS وثابتة في 70٪ إيثانول. عولجت الخلايا الثابتة بـ 500 ميكروغرام / مل من RNaseA لمدة 30 دقيقة عند 37 درجة مئوية ، وأضيف يوديد البروبيديوم إلى تركيز نهائي قدره 50 ميكروغرام / مل. تم إجراء قياس التدفق الخلوي باستخدام عيار FACS (بيكتون ديكنسون).

الترسيب المناعي

تم تحضير مستخلصات الخلايا في محلول تحلل (50 ملي مولار تريس - حمض الهيدروكلوريك ، ودرجة الحموضة 7.5 ، 100 ملي كلوريد الصوديوم ، 5 ملي EDTA ، درجة الحموضة 8.0 ، 0.5 ٪ Nonidet P-40 ، 1 ملي PMSF ، 20 ميكروغرام / مل أبروتينين ، 10 ميكروغرام / مل ليوببتين ، 300 Kunitz U / ml DNase I) ، المحتضنة لمدة 30 دقيقة على الجليد والمحلول بواسطة صوتنة. تمت إزالة المواد غير القابلة للذوبان عن طريق الطرد المركزي عالي السرعة. تمت إزالة مستخلص الخلية الكاملة مسبقًا باستخدام IgG للماوس العادي و 15 ميكرولتر من البروتين المؤتلف G agarose (Invitrogen). تم تحضين العينات بالأجسام المضادة لمدة ساعة عند 4 درجات مئوية. لكل عينة ، تمت إضافة 15 ميكرولتر من بروتين G agarose ، وتم تحضين العينات لمدة ساعة واحدة عند 4 درجات مئوية وغسلها ست مرات باستخدام محلول غسيل (50 ملي مولار تريس - حمض الهيدروكلوريك ، ودرجة الحموضة 7.5 ، 100 ملي كلوريد الصوديوم ، 5 ملي مولار EDTA ، درجة الحموضة 8.0 ، 0.5٪ Nonidet P-40 ، 1 ملي PMSF). تم تصور المجمعات من خلال تحليل لطخة ويسترن. تم الحصول على الأجسام المضادة لـ RPA32 (12F3.3) و Anti-RPA14 (11.1) من GeneTex. تم الحصول على الجسم المضاد Anit-RPA70 (C-21) من التكنولوجيا الحيوية في سانتا كروز. تم الحصول على الجسم المضاد لـ Rad51C من Chemicon. تم الحصول على الأجسام المضادة المضادة لـ XRCC3 (165-100) والمضادة لـ Rad52 (H-300) من Novus Biologicals و Santa Cruz Biotechnology ، على التوالي.

تعبير عابر في خلايا COS7

ال XRCC3 [كدنا] و RPA تم استنساخ (كدنا) في pcDNA3.1 (Invitrogen). ال RAD52 تم استنساخ (كدنا) في pcDNA3.1 / Hygro. تم نقل البلازميدات باستخدام Superfect Transfection Reagent (Qiagen) وفقًا لتعليمات الشركة الصانعة. تم حصاد الخلايا المزروعة لمدة 48 ساعة بعد تعداء في محلول تحلل.

التعبير عن جينات RPA

تم تضخيم الحمض النووي الريبي البشري (كدنا) من (كدنا) المشتق من الدم الطبيعي. تم استخدام البادئات التالية لتضخيم جينات RPA: التمهيدي RPA70 5 ′ (5′-AAGTCTTGGCGGTGGAGCCA-3 ′) RPA70 3 التمهيدي المضاد (5′-AAATCGATTCCATTCTGCC-3) RPA32 5 التمهيدي (5′-) TCGCCTCTTTGCGGAGAAT-3 ′) RPA32 3 أساس مضاد للحساسية (5′-GATTGTGAAACTAGGTCC-3 ′) RPA14 5 كريم أساس (5′-AGCCGCAGTCTTGGACCATA-3) RPA14 3 AAG-ACTC التمهيدي. تم إدخال cDNAs في pCR2.1 ، وتم تأكيد التسلسل. تم إدخال RPA (كدنا) في اتجاه مجرى النهر لمحسن MSV ومروج MMTV. تم نقل خلايا HCT116 بالنواقل وتم اختيارها في وجود 900 ميكروغرام / مل من زيوسين.

التعبير عن جينات RAD52 و RAD51C

الانسان RAD52 تم استنساخ (كدنا) من مكتبة الخصية البشرية (كلونتيك) وإدخالها في اتجاه مجرى محسن MSV ومروج MMTV. RPA14-overexpressing الخلايا و XRCC3 - / - تم نقل الخلايا بالنواقل التي تحتوي على جينات مقاومة للأدوية وتم اختيارها في وجود 200 ميكروغرام / مل هيغروميسين و 900 ميكروغرام / مل زيوسين ، على التوالي. تم نقل المسوخ الذي يعبر عن بروتين XRCC3 المتغير مع RAD52 متجه التعبير و pKO SelectPuro ، وتم اختياره في وجود 1.25 ميكروغرام / مل من بوروميسين لأن الخلايا الطافرة قد تم نقلها بالفعل باستخدام جينات مقاومة hygromycin و Zeocin. تم عزل متحولة التعبير الزائد عن Rad52 بواسطة PCR باستخدام بادئات خاصة بناقل التعبير. الانسان RAD51C تم تضخيم (كدنا) من (كدنا) مشتق من الدم الطبيعي. تم إدخال (كدنا) في نفس المتجه وإدخاله في XRCC3 - / - الخلايا. تم الاختيار في وجود 900 ميكروغرام / مل زيوسين.


أساليب

الطرق العامة والسلالات

تمت زراعة السلالات باستخدام طرق قياسية [10] والحفاظ عليها عند 20 درجة مئوية. تم استخدام سلالة Bristol N2 كسلالة قياسية من النوع البري في جميع التجارب. تم تنفيذ جميع الصلبان وفقًا للطرق القياسية [37]. الأليلات الطافرة المستخدمة مذكورة أدناه بواسطة مجموعة الربط (LG) وقد تم وصفها بواسطة [10] ما لم يذكر خلاف ذلك: (LGII): sma-6 (1482)، (LGIII): lon-1 (e185)، (LGV): lon-8 (hu187), lon-8 (hu188)، (هذه الدراسة)، lon-3 (e2175) ، dbl-1 (nk3) [16], him-5 (e1490)، (LGX): lon-2 (e678). تم استخدام الخطوط المعدلة وراثيا التالية في هذه الدراسة: BW1940 ctIs40 [dbl-1xs] [17] ، JR667 ويس 51 [22] ، KN746 هوكس 96 (هذه الدراسة) ، KN905 هوكس 129 (هذه الدراسة).

تسلسل لون 8

لتضخيم لون 8 cDNA من مكتبة cDNA ثنائية الخميرة (هدية من M. Walhout و M. لون 8 التمهيدي CTGCAGAATTACTGACTGTTGGGATC وموجه التمهيدي إلى الجانب 3 'من pPC86 مع لون 8 التمهيدي CAGTCAGTAATTGCG-GATTTG. تم تنقية جميع المنتجات المضخمة وتسلسلها من كلا الاتجاهين للحصول على الطول الكامل لون 8 تسلسل (كدنا).

لتسلسل ملف لون 8 نسخة موجودة في النوع البري و hu187 الحيوانات ، استخدمنا 1 ميكروغرام من إجمالي الحمض النووي الريبي من N2 و hu187 (انظر أدناه) لتوليد [كدنا] بواسطة RT-PCR باستخدام أوليغو دي تي التمهيدي. ثم قمنا بتضخيم لون 8 (كدنا) باستخدام الاشعال لتسلسل SL1 و CTGCAGATTCCTCGCTTTCGCTG المطابقة للنهاية 3 'من exon الرابع لون 8 وتسلسل المنتجات المنقاة من كلا الاتجاهين للحصول على النوع البري و hu187 تسلسل (كدنا).

العزلة وتوصيف لون 8الأليلات

أليلات الحذف lon-8 (hu187) و lon-8 (hu188) تم إنشاؤها من خلال إنشاء وفرز مكتبة الحذف كما هو موضح في [38]. البادئات المستخدمة لتحديد وتسلسل hu187 أليل الحذف كان TGCAATAGGTGTACGAAAAG و CCACAACACATACATTCCAT كزوج خارجي و GAGTGGAATGCTAATAGGGA و GTGAAGCAGCGTATCAACTA كزوج داخلي. البادئات المستخدمة لتحديد وتسلسل hu188 كان أليل الحذف TTTTCTTTGAGCCGCAAAAT و CAGGTAACGCCATGAGGAAT كزوج خارجي و CAAAGGAGGTCGAAAGTGGA و CCATTCTGGCAGTGATCTCC كزوج داخلي.

قياسات حجم الجسم

تمت مزامنة السلالات عن طريق شطف صفائح 9 سم بلطف من مجموعة سكانية مختلطة لإزالة جميع البالغين واليرقات ، تاركًا البيض غير المقشور. بعد ساعة واحدة تم شطف الصفائح برفق لتجميع اليرقات التي فقست خلال هذه الفترة. بالنسبة لمنحنى النمو ، تم الاحتفاظ بالحيوانات المتزامنة عند 20 درجة مئوية واستخدمت لوحة واحدة من كل سلالة للقياسات في كل نقطة زمنية. تم أخذ عينات من 75 حيوانًا عشوائيًا على الأقل في كل مرة. بالنسبة للتحليل المعرفي ، تم أخذ عنصر تحكم N2 جنبًا إلى جنب مع كل مزامنة لضمان نتائج متسقة حيث قد يختلف حجم الجسم بسبب الظروف الخارجية مثل الرطوبة [11]. للقياس ، تم تركيب الحيوانات على شرائح agarose بنسبة 2 ٪ تحتوي على 10 ملي مولار من أزيد الصوديوم وتم تصويرها على الفور بتكبير 33.5 مرة باستخدام مجهر Zeiss Axioplan2 وكاميرا رقمية Axiovision مرفقة. تم تحديد طول الجسم باستخدام برنامج Object Image 2.13. تم تحليل البيانات باستخدام GraphPad Prism.

Lon-8p :: gfpيبني الانصهار

لتوليد Plon-8 :: gfp بناء الانصهار pGS25 ، تسلسل يقابل منطقة المنبع 2 كيلو بايت حتى exon الثاني من المتوقع لون 8 تم تضخيم النسخة من الحمض النووي الجيني N2 باستخدام الاشعال (PSTأنا) -كتجاككجتاجكتكك و (PSTأنا) -CAAATCCGCAATTACTGACTG. تم استنساخ هذا الجزء في ناقل إدخال pPD95.69 GFP (أ. حريق ، اتصال شخصي) باستخدام PSTأنا موقع الاستنساخ. لإنشاء البنية باستثناء ببتيد الإشارة المتوقع ، pGS26 ، تم تضخيم جزأين من pGS: لون 8 تسلسل المنبع حتى ATG المتوقع باستخدام التمهيدي العكسي (BglII) -ATTCCTCATGGCGTTAC ، وجزء يتكون من نهاية exon الأول حتى بداية exon الثاني باستخدام التمهيدي الأمامي (BglII) -AGTGAGTTGTTAC. تم ربط الأجزاء المهضومة في وقت واحد في pPD95.69 باستخدام PSTأنا موقع الاستنساخ.

تم حقن كل من التركيبات الاندماجية بتركيز 50 نانوغرام / ميكرولتر في dpy-20 (e1282) و N2 الحيوانات التي تستخدم 50 نانوغرام / ميكرولتر pMH86 (تحتوي على النوع البري dpy-20) أو 20 نانوغرام / ميكرولتر من pPY20 (P.T. Yang ، اتصال شخصي) كعلامات حقن مشترك. pPY20 (Pmyo-2 :: طماطم) يعبر عن بروتين الطماطم الفلوريسنت الأحمر [39] في البلعوم. تم إنشاء عدة سطور أظهرت أنماط تعبير متشابهة. هوكس 96 و هوكس 129 تم اختيارهم لمزيد من التحليل.

البقع الشمالية

تم جمع إجمالي الحمض النووي الريبي من مجموعات المرحلة المختلطة من N2 ، lon-8 (hu187), lon-8 (hu188), lon-1 (e185), ctIs40 [dbl-1xs], dbl-1 (nk3) و sma-6 (e1482). تم فصل الحيوانات لمدة 5 دقائق عند 60 درجة مئوية في المخزن المؤقت المحتوي على 2 مجم / مل من بروتيناز K. تم عزل الحمض النووي الريبي باستخدام Trizol LS (Invitrogen) متبوعًا باستخراج الكلوروفورم وترسيب الأيزوبروبانول. تم تحميل 10 ميكروغرام من إجمالي الحمض النووي الريبي في كل ممر بهلام فورمالديهايد بنسبة 6٪. بعد الرحلان الكهربائي ، تم نقل الحمض النووي الريبي إلى غشاء Bio-Rad Zeta-Probe. ال لون 8 تم إنشاء المسبار عن طريق تضخيم لون 8 نسخة من مكتبة (كدنا) باستخدام الاشعال CCCGGGCATGAGGAATTCGCGGTT و CCCGGGTATGATGGAATTATCG. ال لون 1 تم إنشاء المسبار عن طريق تضخيم جزء من exon 6 بمقدار 250 نقطة أساس من الحمض النووي الجيني N2 باستخدام البادئات GATGCCAGCTTTCACCTG و CTCTCATTCGGAACCCGTC. ال eft-2 تم إنشاء المسبار عن طريق تضخيم جزء من 400 نقطة أساس من exon 4 من الحمض النووي الجيني N2 باستخدام البادئات GCACAATCGTCTTCACTGTACC و GTAAGAACCGAAGCGTAGAAC.

قياس التكرار الداخلي

قمنا بمزامنة مجموعات N2 ، lon-1 (e185)، و lon-8 (hu187) كما هو موضح أعلاه. بعد 120 ساعة ، تم جمع الحيوانات وتثبيتها في محلول كارنوي طوال الليل. ثم تم تلطيخ الحيوانات إما بـ DAPI وتحليلها كما هو موصوف [2] ، أو ملطخة بـ PI وتم تحليلها على الفور بواسطة الفحص المجهري متحد البؤر كما هو موصوف [23]. لكل حيوان ، قمنا بعمل كومة متحد البؤر من منطقة الذيل بين نوى خلية التماس V5.ppppp و V6.ppppp. تم قياس محتوى الحمض النووي لجميع النوى تحت الجلد الموجودة بين خلايا التماس هذه (8 نوى لكل حيوان) على النحو المحدد بواسطة مجموع كثافة PI. قمنا بعد ذلك بتقسيم هذا الرقم على متوسط ​​كثافة PI لأربعة نوى عصبية على الأقل من الحبل العصبي البطني من نفس المكدس متحد البؤر للحصول على متوسط ​​نسبة محتوى الحمض النووي تحت الجلد إلى محتوى الخلايا العصبية لكل حيوان.

تجارب RNAi

تم اختيار الحيوانات المستنسخة البكتيرية التي تعبر عن دسرنا للجينات المختارة من مكتبة الحمض النووي الريبي لمختبر أرينجر [40]. خمسون نوع البرية أو lon-8 (hu187) تم وضع يرقات L4 على أطباق تحتوي على ناقلات فارغة ، lon-8 ، dpy-11 أو dpy-18 دسرنا معربا عن البكتيريا ، نمت بين عشية وضحاها عند 15 درجة مئوية ونقلها إلى لوحات RNAi الطازجة. تمت مزامنة السكان عن طريق إزالة الحيوانات بعد 7 ساعات ، وترك ذرية غير مقشورة. نمت هذه الحيوانات عند 15 درجة مئوية لمدة 190 ساعة ، وهو ما يعادل 120 ساعة من النمو عند 20 درجة مئوية [41] ، ثم تم جمعها وقياسها كما هو موضح أعلاه.


خيارات الوصول

احصل على الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


ملخص

يكشف التنميط العميق للنسخة والبروتين أثناء نمو الأوراق عن استجابات غير متوقعة لنقص الماء ، فضلاً عن نقص مفاجئ في تقلبات مستوى البروتين خلال دورة النهار والليل ، على الرغم من التغييرات الواضحة على مستوى النسخ.

  • تعكس أنماط اختلاف النسخ والبروتين المراحل الوظيفية للورقة.
  • ترتبط مستويات البروتين والنسخة جيدًا أثناء تطوير الأوراق ، مع بعض الاستثناءات الملحوظة.
  • لا تتوافق التقلبات النهارية على مستوى النسخ مع التقلبات اليومية المقابلة في البروتين المكتشف.
  • ينتج عن المحتوى المائي المنخفض المستمر في التربة انخفاض نمو الأوراق ، لكن النبات يتكيف على المستويات الجزيئية دون إظهار استجابة نموذجية للجفاف.

أساليب

تحديد SMR الجينات في الذرة

للتعرف على SMR الجينات في الجينوم المرجعي B73 (RefGen_v4) ، استخدمنا التقرير أرابيدوبسيس تسلسل الأحماض الأمينية SIM / SMR [48] كاستعلامات في بحث BLASTP ضد جميع بروتينات الذرة التي تم تنزيلها من قاعدة بيانات Phytozome باستخدام القيمة الإلكترونية 1e-5 وهوية 50٪ كعتبات. تم استخدام الكلمات الرئيسية "الذرة SIM" و "الذرة SMR" كاستعلامات للبحث في مقابل قاعدة بيانات البروتين NCBI. تمت مقارنة نتائج بحث BLASTP وقاعدة البيانات وتحليلها عن طريق التحرير اليدوي. علاوة على ذلك ، تم إجراء BLASTN من الجينوم الخاص به في maizeGDB للعثور على نماذج الجينات المفقودة المحتملة. تم أيضًا إجراء تفجير ذاتي لهذه التسلسلات لإزالة التسلسلات الزائدة عن الحاجة ، ثم تم إرسال التسلسلات المتبقية إلى خادم الويب NCBI-CDD لتأكيد وجود وسلامة المجالات المحفوظة. بعد التصحيح اليدوي ، تم الحصول على بروتينات ZmSMR المفترضة. ثم تم استخدام أداة Expasy ProtParam (https://web.expasy.org/protparam/) و Softberry-ProtComp الإصدار 9.0 (http://www.softberry.com/berry.phtml) لتحديد المعلمات الفيزيائية والكيميائية والتوطين دون الخلوي من بروتينات الذرة SMR ، على التوالي.

العناصر التنظيمية في منطقة المروج ZmSMRs

تسلسل الحمض النووي 1.5 كيلو بايت المنبع من كودون البدء (ATG) لكل منهما ZmSMR تم تنزيله من قاعدة بيانات Phytozome [53]. تم تعيين موقع بدء النسخ على أنه + 1. العناصر الموجودة في أجزاء المروج (من - 1500 نقطة أساس إلى + 1 نقطة أساس) من ZmSMR تم تحديد الجينات باستخدام PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [53 ، 54] ، PlantPan 2.0 (http://plantpan2.itps.ncku.edu.tw) [ 55] وقاعدة بيانات RegSite للعناصر التنظيمية للنبات - برنامج Softberry عبر الإنترنت (http://www.softberry.com/berry.phtml) [56 ، 57].

تحديد الجينات المخلوية

تم تحديد العلاقات التركيبية لجينات الذرة من خلال مقارنة تسلسل جينوم الذرة B73 باستخدام أداة SynMap [58] لموقع CoGe على الويب (https://genomevolution.org/coge/). تم الكشف عن الجينات المخلقة باستخدام بيانات CDS مع الإعدادات الافتراضية باستثناء خوارزمية Quota Align Merge ، وتم تنزيل ناتج مجموعة الجينات التخليقية النهائية مع روابط GEvo لمزيد من التحليل [59].

تحليل النشوء والتطور وتحليل الزخارف المحفوظة

تم إجراء محاذاة تسلسل متعددة لتسلسل البروتين كامل الطول لـ ZmSMRs باستخدام ClustalW كما تم دمجها في MEGA 7.0 مع المعلمات الافتراضية. تم إجراء إعادة البناء الوراثي باستخدام MEGA 6.0 باستخدام طريقة الجار-الانضمام مع 1000 نسخة مكررة من bootstrap [60]. لدراسة العلاقة التطورية لبروتينات SMR في ز. ميس, A. thaliana, يا ساتيفا, S. ثنائي اللون, S. italica, B. ديستاتشيون, ماكس, P. trichocarpa و P. patens، تم استرجاع تسلسلات SMR aa كاملة الطول من قواعد بيانات NCBI و Phytozome. بالإضافة إلى ذلك ، تم إجراء انفجار للجينوم الخاص به لهذه الجينات المكتسبة للعثور على نماذج الجينات المفقودة المحتملة. تم إجراء محاذاة تسلسل متعددة ، وتم رسم شجرة غير مأهولة كما هو موضح سابقًا. بالإضافة إلى ذلك ، لفحص تنوع التراكيب الزخرفية في بروتينات ZmSMR المفترضة ، تم استخدام تعظيم التوقع المتعدد لاستنباط الحافز (MEME) عبر الإنترنت [61] للتنبؤ بالزخارف المحفوظة في هذه البروتينات. تم تحديد الحد الأقصى لعدد الزخارف بستة [62].

أخذ عينات من البذور بمعدلات مختلفة من فوسفات الأمونيوم الثنائي ومعدلات تعبئة الحبوب

الذرة (ز. ميس تم توفير الخط الفطري B73 من قبل المختبر الرئيسي للبيولوجيا والتحسين الوراثي للذرة في المناطق الجافة في المنطقة الشمالية الغربية ، وزارة الزراعة ، كلية الهندسة الزراعية ، جامعة الشمال الغربي A & ampF. نمت الخطوط في الحقل في صيف عام 2012 في Yangling ، شنشي ، الصين. تم التلقيح الذاتي للآذان في نفس اليوم. تم جمع بذور السويداء في نفس الموضع في آذان الذرة كل 5 أيام من 0 إلى 30 فوسفات ثنائي الفينول فوسفات الأمونيوم (5 فوسفات ثنائي فوسفات الأمونيوم للبذور الكاملة) ، وتم تجميدها في النيتروجين السائل ، ثم تخزينها في ثلاجة - 80 درجة مئوية. تم عزل الحمض النووي الريبي من جزء من البذور واستخدم في اختبار التعبير النسبي لـ SMR الجينات أثناء تطوير السويداء. تم الاحتفاظ ببقية البذور عند 105 درجة مئوية لمدة نصف ساعة لإلغاء تنشيطها ثم تم تجفيفها إلى وزن ثابت عند 80 درجة مئوية. تم حساب معدل ملء الحبوب بقسمة زيادة وزن مائة حبة على عدد الأيام والحبوب بين مرحلتي تعبئة حبوب متجاورتين [16]. تم إجراء ثلاث مكررات بيولوجية في تحليل qRT-PCR.

ظروف نمو النبات وعلاجات الإجهاد

تم غمر سلالة الذرة الفطرية B73 في 10٪ H2ا2 لمدة 30 دقيقة للتطهير ثم تمت معالجتها بـ 3٪ CaSO3 لمدة 3 ساعات لتعزيز الإنبات. تمت زراعة البذور المعالجة في محلول Hoagland في دفيئة تحت ضوء 14 ساعة ودورة مظلمة لمدة 10 ساعات عند 23 ± 1 درجة مئوية. Leaves were collected from maize seedlings at the three-leaf stage and were then used in the expression profiling of ZmSMR genes under ABA, heat, cold, salt, and drought stresses. For heat and cold stress, the maize seedlings were placed in 42 °C and 4 °C environments, respectively. The maize seedlings were immersed in a 100 μM ABA solution for hormone treatment. For these three stresses, the leaves from the seedlings were collected after 2, 6, 12, and 24 h. The solutions for salt and drought treatments were prepared by adding NaCl (200 Mm/L) and PEG [20% (m/v)] to full-strength Hoagland’s solution, respectively. Both treatments lasted 12 h, 24 h, 48 h, and 72 h. Control check (CK) seedlings were kept in the unstressed growth conditions. Three biological replicates were performed in the qRT-PCR analysis.

RNA isolation and quantitative real-time PCR

Total RNA was extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit (Takara, Dalian, China). RNase-free DNase-I was used to remove any contaminating genomic DNA in the solution. First-strand cDNA synthesis was conducted using a FastQuant RT Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The qRT-PCR analysis of all 12 ZmSMRs was performed using primers that were designed according to the ZmSMRs’ sequences and using an NCBI Primer-BLAST online instrument (Additional file 11). The amplification products were controlled within a size range of 130 bp to 250 bp (Additional file 11). The maize الأكتين (Zm00001d013873) gene was used as an internal control. All primers were synthesized by Sangon Biotech Company. The qRT-PCR assays were performed in optical 96-well plates with three technical replicates using the BIO-RAD CFX96 Detection System (Bio-Rad, CA, USA). Each reaction was performed in 20 μL of a SuperReal Premix Plus (SYBR Green) reaction mixture (TIANGEN, Beijing, China), following the manufacturer’s instructions. The relative expression ratio of each gene was calculated using the 2 - △ △ CT method [63].


شاهد الفيديو: المحاضرة الثالثة احياء دقيقة الجزء الأول (قد 2022).


تعليقات:

  1. Janyl

    أنا محدود ، أعتذر ، لكن هذه الإجابة لا تقترب مني. من غيرك يستطيع أن يقول ماذا؟

  2. Dwane

    بالتاكيد. أنا متفق على كل ما سبق. دعونا نناقش هذه القضية. هنا أو في PM.

  3. Ablendan

    هذا يبدو مغريًا جدًا

  4. Mezigami

    انت على حق تماما



اكتب رسالة